SGN Marker T1968

SGN-M2962
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39814)
Chromosome
11
Position
5.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1968 was used as an overgo probe on plate 3 [well C1]

Plausible BAC Matches:   P103N06,   P079H20

 Overgo Sequences

A sequence
TGGCTACTACTGCAAGGGCTGATT
B sequence
ATACCATAAGGTGGTGAATCAGCC
AB sequence
TGGCTACTACTGCAAGGGCTGATTCACCAC
Marker sequence
GCCAAAATGGCCACACCTACTATTATTTTGAGCTTCTTGTTGATTTTTGG
AGTGGCTATTTGTCAAAGTGAAGCTAGGGCATTTTTTGTGTTTGGTGATT
CACTTGTTGATAGTGGAAATAATAATTATTTGGCTACTACTGCAAGGGCT
GATTCACCACCTTATGGTATTGATTATCCAACACGTAGAGCAACTGGTCG
TTTCTCTAATGGCTACAACATTCCTGACATTATCAGTCAACAAATTGGTT
CATCAGAGTCACCACTACCTTACTTAGATCCAGCTCTTACTGGACAAAGA
CTTCTTGTTGGTGCTAACTTTGCATCTGCTGGAATTGGAATACTAAATGA
CACTGGAATCCAATTTATTAATATTATTCGAATGCCACAACAATTGGCTT
ATTTTAGACAATATCAAAGTAGAGTAAGTGGCCTTATTGGTGAAGCAAAT
ACTCAAAGACTTGTAAATCAAGCTCTTGTTCTTATGACTCTTGGAGGCAA
TGATTTTGTCAACAACTATTATCTTGTGCCCAATTCTGCGCGATCACGCC
AATTTTCTATTCAAGATTATGTCNCCTTATTTGATAA
Genomic location of T1968  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2962 marker 2962
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)