SGN Marker cLEB-7-L1

SGN-M2965

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C648
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40269)
Chromosome
11
Position
46.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLEB-7-L1 was used as an overgo probe on plate 10 [well B10]

Plausible BAC Matches:   P117L07,   P247H18,   P128G07,   P170K16,   P291E11,   P278G09,   P064J13,   P260P12,   P147P20,   P276L12,   P328D01

 Overgo Sequences

A sequence
CAGAGATGGAGATCTGCTCTTCTC
B sequence
ATGGTCCTTAGCGCAAGAGAAGAG
AB sequence
CAGAGATGGAGATCTGCTCTTCTCTTGCGC
Marker sequence
AAAGAATTCGGCACGAGCGGCGACGAACAACAATCTCACTGAGAGAATCA
CTCCGGCGACCGACTACAAACAACGATGAGGCCAATATTGATGAAGGGCC
ATGAAAGGCCGTTAACTTTTCTAAAGTACAACAGAGATGGAGATCTGCTC
TTCTCTTGCGCTAAGGACCATACCCCTACCGTTTGGTTTGCCGATAACGG
CGAGCGCCTCGGCACTTACCGTGGCCATAACGGTGCCGTTTGGTGCTGTG
ACGTTTCTCGGGATTCGTCCAGGCTAATAACTGGAAGTGCGGATCAGACT
GCAATGTTGTGGGATGTCCAAACTGGTGCCCAGCTGCACACGTTCACCTT
TGACTCCCCTGCTAGGTCTGTTGATTTTTCAGTTGGCGATAAACTCGCAG
TGATCACCACTGATCCTTTTATGGGACTGACATCTGCTATCCATATCAAA
AATATCAGCAAAGATCCCAGTGAACAAATGAGTGAGTCGGTGCTCGTCTT
AAAGGGTCCCCAGGGAAGAATCAACAGAGCTGTGTGGGGACCCCTGAATA
AAACAATTATAAGTGCTGGTGAAGATGCTGTAATACGTATCTGGGATGCT
GAGACTGGAAAGGTACTGAAAGAGTCTGACAAAGAAA
Genomic location of cLEB-7-L1  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2965 marker 2965
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)