SGN Marker cLEC-24-C3

SGN-M2968

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C4247
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40275)
Chromosome
11
Position
76.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35660
Forward primer (5'-3')
AGATCGGCAAATGATCCAAG
Digested band sizes (using EcoRI)
Solanum pennellii LA716: 1250
Solanum lycopersicum LA925: 950
Mg+2 concentration
3mM
Reverse primer (5'-3')
ACTTGTGGCGAAAAATGAGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1250
Solanum lycopersicum LA925: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 142
Forward primer (5'-3')
Unknown
Digested band sizes (using EcoRI)
Solanum lycopersicum LA925: 950
Solanum pennellii LA716: 1250
Mg+2 concentration
3mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1250
Solanum pennellii LA716: 1250
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
cLEC-24-C3 was used as an overgo probe on plate 10 [well B8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GCACTACTAGAACGCACGATCAAG
B sequence
GCAGGAAAAGCATGTGCTTGATCG
AB sequence
GCACTACTAGAACGCACGATCAAGCACATG
Marker sequence
GAAAGAACTGCGAGAAATTGTTCCAAATGGGGCAAAGTGTAGCATTGATG
CACTACTAGAACGCACGATCAAGCACATGCTTTTCCTGCAGAGCGTCACA
AAACATGCGGACAAATTAAAACAGACTGGAGAGTCAAAGATTATCAGCAA
GGAAGGAGGGTTGCTTTTGAAAGATAATTTTGAAGGAGGAGCGACATGGG
CATATGAAGTTGGTTCACAGTCTATGGTCTGCCCGATTATAGTTGAGGAT
CTGAATCAACCTCGTCAAATGCTCGTGGAGATGCTTTGTGAAGAACGCGG
TCTATTTCTGGAAATAGCTGACATAATAAGAGGATTGGGCTTGACCATCT
TAAAAGGGGTTATGGAAACGAGGAACGACAAAATATGGGCGAAATTCGCT
GTAGAGGCAAATAGAGACGTGACGAGGATGGAGATATTCATCTCACTTGT
TCGCCTCTTGGAGCAAACATCAAAAGGC
Genomic location of cLEC-24-C3  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2968 marker 2968
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)