SGN Marker cLPT-5-K19

SGN-M2969

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C110620
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40472)
Chromosome
11
Position
77.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLPT-5-K19 was used as an overgo probe on plate 10 [well D5]

Plausible BAC Matches:   P171G16,   P300O16,   P299C20

 Overgo Sequences

A sequence
TGGGATGAACTTGTGGTCTTTGCC
B sequence
ACCTTGGGTTCCAGAAGGCAAAGA
AB sequence
TGGGATGAACTTGTGGTCTTTGCCTTCTGG
Marker sequence
TGCCACTGGAAGTGGCAAAGAAAGTGAAGATCGCAGTGTTAATCAGGATG
GTAATGGGAACCTTGAATTCTCGAACAATGCATTTGATCTTGAGGCCATC
TCTCTTAATATTGACCCACCATATGGTTTTGGCAACGGAAATCCGTCAAT
ACCAGCAGGAGATGCTGAAGTTATTGTACTAAGTGATTCTGATGAAGAGA
ATGAACCAATTATCCCATCTGGAGCTGTCTTTAATAACAGCCATAGTGAT
GCACCTGTAGTTTCTTTTCCAGCTCAACCACTAAGAATTCCGGATTCTTT
TCATGATTCTGCGCTTGTTAACGGTGGGAATTCATGCCTGGGGCTGTTCA
ATTCTAATGACGATGAATTTGGGATGAACTTGTGGTCTTTGCCTTCTGGA
ACCCAAGGTGGCCCTGGTTTTCAGTTATTTAGTTCTGATGCTGATGTTTC
AAGATCTTTAGTAGATGTGCAACATGAATCTATTAACTG
Genomic location of cLPT-5-K19  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2969 marker 2969
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)