SGN Marker T1952

SGN-M2970
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39801)
Chromosome
11
Position
77.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1952 was used as an overgo probe on plate 10 [well E2]

Plausible BAC Matches:   P195E11

 Overgo Sequences

A sequence
GACAAACTTGGGATGCGAGGAAGT
B sequence
CAAGCTCACATGTGTCACTTCCTC
AB sequence
GACAAACTTGGGATGCGAGGAAGTGACACA
Marker sequence
GGAACCCATGAGCAGAAACAAAAGTTTCTACCAAAGCTAATCAGTGGTGA
GCATGTGGGGGCTCTAGCTATGAGTGAACCTAATGCTGGATCAGATGTTG
TTAGCATGAAGTGCAAAGCTGACCATGTTGAGGGTGGTTATGTTCTGAAT
GGAAACAAAATGTGGTGCACAAATGGTCCAACGGCTCAGACGCTGGTTGT
TTATGCAAAAACGGATGTCACAGCCGGTTCAAAAGGAATCACAGCATTCA
TTATCGAGAAGGAAATGACAGGATTCTCTACTGCCCAGAAATTAGACAAA
CTTGGGATGCGAGGAAGTGACACATGTGAGCTTGTGTTTGAGAACTGTTT
TGTTCCTGAAGAAAATGTTCTGGGGCAAGTAGGAAAAGGTGTTTATGTCC
TGATGTCNGGGCTTGATCT
Genomic location of T1952  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2970 marker 2970
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)