SGN Marker cLET-5-E4

SGN-M2971

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C87614
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40398)
Chromosome
11
Position
82.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-5-E4 was used as an overgo probe on plate 10 [well G4]

Plausible BAC Matches:   P020J08

 Overgo Sequences

A sequence
ATTACCGTCAGGACTGTTACCACC
B sequence
AACGCGCTGGAAACTTGGTGGTAA
AB sequence
ATTACCGTCAGGACTGTTACCACCAAGTTT
Marker sequence
CAGGCATACAGGGAGCCAGGCATGCTCAATTTGGAGTACCTTTATTGGAT
CTTCACCTTAGCAACAAATTACCGTCAGGACTGTTACCACCAAGTTTCCA
GCGCGTTGCAGCCAACTCACAACTTCCTAATGTCATCAATAAGTGCCAAA
ATGACAGAAATGATAACATCTCTTGTTTGCTTACAATGGGTACTTCAAGT
AAGACATTGGACAAAAATGATAGTGTGAATACACCTCGGTTCTTACTCTT
CGGTCAGCCAATTCTGACTGAGCAACAAATCTCTAATGGATGTTCTGTCA
GTGCTCCACAAGTAGTCCAAACAGGGAAAGA
Genomic location of cLET-5-E4  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2971 marker 2971
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)