SGN Marker T1949

SGN-M2973
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39800)
Chromosome
11
Position
91.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1949 was used as an overgo probe on plate 10 [well B12]

Plausible BAC Matches:   P089M02,   P150L11

 Overgo Sequences

A sequence
GATCACCCGAAGTTCAAGAGGAAG
B sequence
CAAACAGGTCATCACCCTTCCTCT
AB sequence
GATCACCCGAAGTTCAAGAGGAAGGGTGAT
Marker sequence
TTTCAATCAGACAGCTTGGGCCTGGAATGATCCAGCAAATGCAGCAGCCT
TGTAATAAATGCAAGGGTACTGGAGAGACAATTGACGATAAGGATCGTTG
TCCTCAATGCAAAGGTAAAAAAGTGGTACCAGAGAAGAAAGTCATTGAAG
TCCATGTTGAAAAAGGAATGCAAAATGGACAGAAAATTACATTCCCTGGC
GAGGCTGATGAAGCGCCTGATACAGTTACTGGAGATGTGGTTTTCGTTCT
CCAACAGAAAGATCACCCGAAGTTCAAGAGGAAGGGTGATGACCTGTTTG
TTGATCACACATTGACCTTAACTGAGGCACTGTGTGGTTTCCAGTTCATA
TTGGCACACTTGGATGGCAGACGGCTCCTCGTAAAGTCAAACCCTGGAGA
AGTTGTTAAACCTGATCAATTCAAGGCTATCAATGATGAAGGAATGCCAG
TTTACCAGAGGCCATTCATGAAGGGTAAACTGTACATTCATTTCATCGTG
GAATTCCCGGATTCGTTGAGCCTGCCACAGGTGCAGCTTCTGGAGGCAAT
GTTACCATCAAGGCCTACATCACAGTACTCTGACATGGAACTGGATGAAT
GTGAGGAGACCACATTGCATGATGTG
Genomic location of T1949  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2973 marker 2973
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)