SGN Marker cLET-24-J2

SGN-M2974

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C83410
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40373)
Chromosome
11
Position
94.00 cM
Confidence
F(LOD3)
Protocol
CAPS
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40374)
Chromosome
3
Position
70.00 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35664
Forward primer (5'-3')
CAACCATCCTAGCAATGAAATCT
Digested band sizes (using KpnI)
Solanum lycopersicum LA925: 180+220
Solanum pennellii LA716: 400
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GAGGCATTCACTCTCTTCGATAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 400
Solanum lycopersicum LA925: 400
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
cLET-24-J2 was used as an overgo probe on plate 10 [well C8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATCTCCTCCATGAAGGAGGCATTC
B sequence
CGGTATCGAAGAGAGTGAATGCCT
AB sequence
ATCTCCTCCATGAAGGAGGCATTCACTCTC
Marker sequence
GAAAGATCTGAGCAACGATCAAATCTCCTCCATGAAGGAGGCATTCACTC
TCTTCGATACCGACGGCGACGGCAAAATATCACCGTCGGAGCTAGGTATC
CTAATGCGTTCACTCGGAGGTAATCCGACTCAAGCTCAACTCAAATCAAT
AATCGCCGAGGAAAAACTCACATCGCCGTTCGATTTCAACCGGTTTATGG
AACTCATGTCGAAACACTTGAAGCCGGAGCCATTTGATCGCCAATTACGC
GATGCGTTCAAGGTACTTGATAAAGACGGTACCGGTTTCGTTGTTGTTTC
GGATCTAAAGCATATTTTAACTAGTATTGGTGAGAAGCTTGAGCCTTCGG
AATTTGATGAGTGGATCCGAGAAGTTGATGCTGGATCCGATGGTAAGATC
CGGTATGAAGATTTCATTGCTAGGATGGTTGCCAAGTGATTTTTGCATGA
TTTTCATCTTCGGCTATATTACTCAATAGCAAGAAACAGGACCTGACTTT
GCCCTCGCTAGTTNTGCCCTCTCATTTGTATGTTTTAAGGGGATCTTTCA
TTA

cLET-24-J2 was used as an overgo probe on plate 9 [well C3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATCTCCTCCATGAAGGAGGCATTC
B sequence
CGGTATCGAAGAGAGTGAATGCCT
AB sequence
ATCTCCTCCATGAAGGAGGCATTCACTCTC
Marker sequence
GAAAGATCTGAGCAACGATCAAATCTCCTCCATGAAGGAGGCATTCACTC
TCTTCGATACCGACGGCGACGGCAAAATATCACCGTCGGAGCTAGGTATC
CTAATGCGTTCACTCGGAGGTAATCCGACTCAAGCTCAACTCAAATCAAT
AATCGCCGAGGAAAAACTCACATCGCCGTTCGATTTCAACCGGTTTATGG
AACTCATGTCGAAACACTTGAAGCCGGAGCCATTTGATCGCCAATTACGC
GATGCGTTCAAGGTACTTGATAAAGACGGTACCGGTTTCGTTGTTGTTTC
GGATCTAAAGCATATTTTAACTAGTATTGGTGAGAAGCTTGAGCCTTCGG
AATTTGATGAGTGGATCCGAGAAGTTGATGCTGGATCCGATGGTAAGATC
CGGTATGAAGATTTCATTGCTAGGATGGTTGCCAAGTGATTTTTGCATGA
TTTTCATCTTCGGCTATATTACTCAATAGCAAGAAACAGGACCTGACTTT
GCCCTCGCTAGTTNTGCCCTCTCATTTGTATGTTTTAAGGGGATCTTTCA
TTA
Genomic location of cLET-24-J2  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2974 marker 2974
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)