SGN Marker TG10

SGN-M298

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
900
Vector
pUC
Cutting Site
EcoR1/HindIII
Drug Resistance
AMP
Image
TG10 image not available
Forward sequence
AACTCTGCTCTGCCAATAGTAGTCAGGCAGATCAAGATGCTCAAAATTTTCTATTTGAATTGGAAGCATCAAGATGGTTCTTAGCATTTA
TTTTAGAAAGACTAACCATATTATCAAATAACCAGACTGAGACGCACACAAAAGTTTCCCTCTATTATTTTTATAATGATGTGAAGATGC
TACATAATGAGTACACTTTGCCTTACTTTACTGCAGATGGACCTACCAGGCCCAAACGGACATGTAGCTATGACAGAAGAGCAACCGCTA
TGAATGTCTCAAACTGTTGGCCTAGGCGATCAGCACAGATGATGAATCTGGAAGTACATTCCAAGAAGGAAAGCTGGAGCGTGGGAACTA
ACCAGATGCAGGGGATGAATCCACACCTTTCAGTTGATCATCTGAAGGGAAAACTAAGAATTTTCATGAGAAAATGACTGGCTATTTTCA
ACTTTG
Reverse sequence
TTCAATGCATTTAAGCTCAAAAAAACAAAGCTGTAGGAAGGAGCATATTAGTAGCCTAACTCTGCTCTGCCAATAATAGTTAAGCAGATC
AAGATGCTCAAAATTTTCTAATTGAATTGTTAGCATCAAGATGCTTCTTAGCATTTATTTTAGAAAGATTAACCATATTATCAAATAACC
AGACAGAGACGCACACAAAAGTTTCAATCTATTATTTTTATAATGATGTGAAAATGCTACATAATGAGTACACTTTCCCTTACTTTACTG
CAGATGGACCTACCAGGCCCAAACGGTCATGTAGTTATGACAGAAGAACAACAGTATGAATTTCTCAAACTGTTGGCCAAGGTGATCAGC
AAAGATTATGAATTTGGAAGTACATTCCAAGAGGAAAGCTGGAGCATCGTAACTAACCAGATGCAGGGGATGAATCCACACCTTTCAGTT
GATCATCTGAAGGCAAAACTAAGAATTTTCATGAGAAAATACTGGTTATTTTCAACTTTGTTGGCCAGACGAGGAGTCCAATGGGATAGA
AGGACTAACTCAATGACGTATG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53153)
Chromosome
9
Position
40.83 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_9
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42401)
Chromosome
9
Position
4.60 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Eggplant-LXM 2002   
Map version
29 (location: 8835)
Chromosome
9
Position
5.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8834)
Chromosome
9
Position
34.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8836)
Chromosome
9
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG10 was used as an overgo probe on plate 15 [well C7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTCTGCTCTGCCAATAGTAGTCAG
B sequence
GAGCATCTTGATCTGCCTGACTAC
AB sequence
CTCTGCTCTGCCAATAGTAGTCAGGCAGAT
Marker sequence
AACTCTGCTCTGCCAATAGTAGTCAGGCAGATCAAGATGCTCAAAATTTT
CTATTTGAATTGGAAGCATCAAGATGGTTCTTAGCATTTATTTTAGAAAG
ACTAACCATATTATCAAATAACCAGACTGAGACGCACACAAAAGTTTCCC
TCTATTATTTTTATAATGATGTGAAGATGCTACATAATGAGTACACTTTG
CCTTACTTTACTGCAGATGGACCTACCAGGCCCAAACGGACATGTAGCTA
TGACAGAAGAGCAACCGCTATGAATGTCTCAAACTGTTGGCCTAGGCGAT
CAGCACAGATGATGAATCTGGAAGTACATTCCAAGAAGGAAAGCTGGAGC
GTGGGAACTAACCAGATGCAGGGGATGAATCCACACCTTTCAGTTGATCA
TCTGAAGGGAAAACTAAGAATTTTCATGAGAAAATGACTGGCTATTTTCA
ACTTTG
Genomic location of TG10  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D298 marker 298
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)