SGN Marker cLEX-11-K1

SGN-M2984

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C92537
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40431)
Chromosome
12
Position
57.90 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40432)
Chromosome
8
Position
18.00 cM
Confidence
F(LOD3)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40433)
Chromosome
12
Position
58.00 cM
Confidence
I
Protocol
RFLP
Subscript
C


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLEX-11-K1 was used as an overgo probe on plate 14 [well D2]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P166L22,   P017G02,   P213J10,   P166A16,   P118B10,   P154K24,   P202E17,   P118A08,   P120K14,   P033D06,   P316G24,   P273L05,   P179I20,   P022C08,   P037O01,   P231D19,   P232D23,   P101K13,   P141H05,   P191E15,   P214J07,   P300H17,   P202M03,   P052E06,   P195A10,   P112N24,   P185D02

 Overgo Sequences

A sequence
GTTGAAGACGCTCTTGCACATCCT
B sequence
GGAGCGATGTTAGGTAAGGATGTG
AB sequence
GTTGAAGACGCTCTTGCACATCCTTACCTA
Marker sequence
TGAGGAGCACTGCCAGTATTTCTTGTATCAGATCCTCCGTGGGTTGAAAT
ACATACATTCTGCAAATGTTTTGCACAGAGACTTAAAGCCTAGCAATCTT
CTCTTGAATGCCAACTGTGATTTGAAGATATGTGATTTTGGGCTAGCTCG
TGTCACTTCTGAAACTGACTTTATGACCGAATATGTTGTGACAAGATGGT
ATCGTCCACCTGAGCTGTTGTTGAATTCATCCGACTATACTGCAGCAATT
GATGTATGGTCAGTGGGTTGCATCTTCATGGAGTTGATGGACAGAAAACC
CCTCTTCCCTGGCAGAGATCATGTACACCAGCTGCGTCTTATTATGGAGT
TGATTGGCACTCCTTCAGAGGCTGAAATGGAATTTTTAAATGAGAATGCA
AAACGCTATATCCGACAACTTCCTCTTTACCGTCGACAATCATTTACTGA
AAAGTTCCCGCATGTAAACCCAGCTGCTATTGATCTTGTCGAGAAAATGT
TGACATTTGATCCCAGAAGGAGAATAACAGTTGAAGACGCTCTTGCACAT
CCTTACCTAACATCGCTCCATGATATCAGTGACGAGCCCATTTGCATG

cLEX-11-K1 was used as an overgo probe on plate 12 [well A11]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P179I20,   P232D23,   P194I19,   P231D19,   P166A16,   P166L22,   P316G24,   P120K14,   P202E17,   P154K24,   P052E06,   P202M03,   P300H17,   P185D02,   P304A06,   P112N24,   P101K13,   P214J07,   P191E15,   P141H05

 Overgo Sequences

A sequence
GTTGAAGACGCTCTTGCACATCCT
B sequence
GGAGCGATGTTAGGTAAGGATGTG
AB sequence
GTTGAAGACGCTCTTGCACATCCTTACCTA
Marker sequence
TGAGGAGCACTGCCAGTATTTCTTGTATCAGATCCTCCGTGGGTTGAAAT
ACATACATTCTGCAAATGTTTTGCACAGAGACTTAAAGCCTAGCAATCTT
CTCTTGAATGCCAACTGTGATTTGAAGATATGTGATTTTGGGCTAGCTCG
TGTCACTTCTGAAACTGACTTTATGACCGAATATGTTGTGACAAGATGGT
ATCGTCCACCTGAGCTGTTGTTGAATTCATCCGACTATACTGCAGCAATT
GATGTATGGTCAGTGGGTTGCATCTTCATGGAGTTGATGGACAGAAAACC
CCTCTTCCCTGGCAGAGATCATGTACACCAGCTGCGTCTTATTATGGAGT
TGATTGGCACTCCTTCAGAGGCTGAAATGGAATTTTTAAATGAGAATGCA
AAACGCTATATCCGACAACTTCCTCTTTACCGTCGACAATCATTTACTGA
AAAGTTCCCGCATGTAAACCCAGCTGCTATTGATCTTGTCGAGAAAATGT
TGACATTTGATCCCAGAAGGAGAATAACAGTTGAAGACGCTCTTGCACAT
CCTTACCTAACATCGCTCCATGATATCAGTGACGAGCCCATTTGCATG
Genomic location of cLEX-11-K1  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2984 marker 2984
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)