SGN Marker cLET-8-G15

SGN-M2986

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C88483
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51105)
Chromosome
12
Position
44.61 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49041)
Chromosome
12
Position
60.49 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40421)
Chromosome
12
Position
60.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-8-G15 was used as an overgo probe on plate 14 [well H8]

Plausible BAC Matches:   P042B11,   P179C18,   P011M15,   P114M03,   P049G24,   P124A10,   P124L18,   P161H15,   P243O03,   P189H16,   P286H11,   P143D14,   P025H16,   P031J21,   P105L23,   P094C12,   P143E12,   P266F15,   P313J18,   P086G06,   P306A12

 Overgo Sequences

A sequence
AGTGGGACTTGTATGGCTCAGATG
B sequence
TTGTATGGTGAGGGTGCATCTGAG
AB sequence
AGTGGGACTTGTATGGCTCAGATGCACCCT
Marker sequence
TGGTTGCAAAGTATGGTGACAAGAGTGTATATTTTGATTTAGAGGACTTG
GGCAACACCACTGGTCAGTGGGACTTGTATGGCTCAGATGCACCCTCACC
ATACAACTCCCTTCAGAGCAAGTTCTTCGAGACCTTTGCTGCTCCTTTCA
CCAAGAGAGGACTGTTGCTTAAATTCTTGATACTGGGAGGTGGCTCAACT
CTTGCATACTTCAGTTCAACAGCATCAGGGGATATACTACCAATTAAGAA
AGGGCCGCAACTTCCACCCAAGCTTGGTCCACGCGGAAAGATCTAATTTC
TTTTCAATCAAGCTTTCTCAACCTTCATTTTGTAATTGATGTATCTGTCG
TCAGCTTGTAAGTATTCTTGAAGCCTACAACATGAGACCTTTGTTACAAG
AAGTTAAATCTTATGGC
Genomic location of cLET-8-G15  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2986 marker 2986
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)