SGN Marker T1947

SGN-M2989
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39798)
Chromosome
12
Position
65.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1947 was used as an overgo probe on plate 15 [well A1]

Plausible BAC Matches:   P145K17,   P077H15,   P029C17,   P073C03,   P124G18

 Overgo Sequences

A sequence
AGTGCTGCTGGAGATTGGGTTAAC
B sequence
CACCACAAATCCCACAGTTAACCC
AB sequence
AGTGCTGCTGGAGATTGGGTTAACTGTGGG
Marker sequence
GCACCAGGTGGGCGAAGCCCAATACATGTGTGTTCTGAGGAGGAATTTCT
GAAAGATGTAATGCAGTTTTTAATTCTTCGTGGGCATACTCGTCTCATTC
CTCAAAGTGGCATTGCTGAGTTTCCAGACGCTATTCTCAATGCCAAACGC
CTTGACCTCTTTAACTTGTATAGGGAGGTGGTTTCAAGGGGTGGGTTTCA
TGTTGGCAACGGCATCAATTGGAAAGGGCAAGTTTTCTCAAAGATGCGAA
ATCACACAGTAACCAATAGGATGACTGGTGTTGGGAATACACTTAAAAGA
CATTATGAAACTTACCTTTTGGAGTATGAATTGGCTCATGATGATGTTGA
TGGAGAGTGCTGCTTGTTATGTAACAGTAGTGCTGCTGGAGATTGGGTTA
ACTGTGGGATTTGTGGTGAGTGGGCACATTTTGGCTGTGATAGAAGACCA
GGTCTCGGCGCCTTCAGGACTATGCAAAGACAGATGGACTGGAATACATA
TGTCCGCAATGCAGCGTGACTAATTTT
Genomic location of T1947  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2989 marker 2989
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)