SGN Marker cLER-1-H17

SGN-M2992

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C72198
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40345)
Chromosome
2
Position
0.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLER-1-H17 was used as an overgo probe on plate 10 [well B11]

Plausible BAC Matches:   P271A19,   P312K19,   P227P18,   P067J01,   P308F10,   P200B01,   P157E06,   P144L11,   P288C05,   P146M10,   P308P01,   P183C03,   P047K01,   P300J03,   P022L22,   P332P20,   P220E21,   P146L13,   P306G12,   P272J02,   P248H06,   P204F15,   P059M01,   P011L02,   P106M18,   P003O02,   P319N16,   P161N19,   P321G14,   P142K01,   P028F14,   P185H03,   P129A21,   P027A13,   P281B05,   P158K23,   P122A18,   P106I02,   P225N15,   P025N04,   P007F24,   P005I18,   P098O14,   P267A05,   P139G22,   P002G03,   P310O16,   P051B06,   P163H01,   P039C22,   P288D05,   P323A18,   P022E21,   P160K24,   P068F09,   P331H22,   P104C01,   P003H14,   P099F01,   P115L01,   P139H22,   P287D19,   P007B14,   P132A10,   P284B01,   P290N04,   P294L19,   P165A05,   P255C18,   P182B21,   P199C04,   P335D08,   P228L19,   P306D17,   P320L01,   P182D04,   P063E22,   P321D14,   P259A12,   P173D17,   P215A07,   P209G22

 Non-Plausible BAC matches

P169I15,   P333N08,   P100A22,   P271E01,   P015N08,   P193N14,   P142A15,   P042G05,   P106L11,   P174O05,   P154C21,   P332L19,   P100J15

 Overgo Sequences

A sequence
TGACAGACTGAGAGCTCTTTCTTG
B sequence
CCACCACCCATAGAATCAAGAAAG
AB sequence
TGACAGACTGAGAGCTCTTTCTTGATTCTA
Marker sequence
TCCAGACATAGTAAGGATTGACAGACTGAGAGCTCTTTCTTGATTCTATG
GGTGGTGGTGCATGGCCGTTCTTAGTTGGTGGAGCGATTTGTCTGGTTAA
TTCCGTTAACGAACGAGACCTCAGCCTGCTAACTAGCTATGCGGAGGTAT
CCCTTCGCGGCCAGCTTCTTAGAGGGACTACGGCCTTTTAGGCCGCGGAA
GTTTGAGGCAATAACAGGTCTGTGATGCCCTTATATGTTCTGGGCCGCAC
GCGCGCTACACTGATGTATTCAACGAGCTTATAGCCTTGGCCGACAGGCC
CGGGTAATCTTTGAAATTTCATCGTGATGGGGATAGATCATTGCAAGTGT
TTGATGTGTTCCCTCTGGAAGAGC
Genomic location of cLER-1-H17  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2992 marker 2992
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)