SGN Marker cLEC-7-P21

SGN-M2994

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C14449
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51066)
Chromosome
2
Position
12.28 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49002)
Chromosome
2
Position
2.98 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40289)
Chromosome
2
Position
0.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35662
Forward primer (5'-3')
TGAACAGAAAGCACGAGTGG
Digested band sizes (using HaeIII)
Solanum pennellii LA716: 300+50
Solanum lycopersicum LA925: 350
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GACAGTTCTTCGAAGCGTTTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 350
Solanum pennellii LA716: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 20
Forward primer (5'-3')
Unknown
Digested band sizes (using HaeIII)
Solanum lycopersicum LA925: 350
Solanum pennellii LA716: 50+300
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 350
Solanum lycopersicum LA925: 350
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
cLEC-7-P21 was used as an overgo probe on plate 10 [well E8]

Plausible BAC Matches:   P317J22,   P122K04,   P291H11,   P001M21,   P060G11,   P296D15,   P016B20,   P279P06,   P068C05,   P330M07,   P059N06,   P046C15,   P096F14,   P224D13,   P128K23,   P326O17,   P062D11,   P266P05,   P291D06,   P313L21,   P242F06,   P323C04,   P298P03,   P007E15,   P303B01,   P198H06,   P155O16,   P048K10,   P031F23,   P305A17,   P224P20

 Overgo Sequences

A sequence
CGCTTCGAAGAACTGTCTCAATGG
B sequence
GGGAGAAACCTTTCTTCCATTGAG
AB sequence
CGCTTCGAAGAACTGTCTCAATGGAAGAAA
Marker sequence
CAGAATCAGATCAATGAGAAGATGATTGAACAGAAAGCACGAGTGGTGTC
CCCTTACTTTTTGAACTCAAGGAATGGAGAAACTGAAGGTTGTGGACTGA
AAGCTGGTAAAACTGTGTTCGAGCCTTGCTTATCTCAAAATCAGATCAAT
GAGAAGATGATTGAACAGAAAGCACGAGCGGTTTGCCCTTACTTTTTGAA
CTCAAGGAATGGAGAAACTGAAATGAAAAAAGGCAGGTCTGTAGAATGTG
TGAAGAAAAGAAATGATAAAAAATTACGAACCAAAGTTCGAGTGGTTTCC
CCTTACTTTGCTAACTTAAAAGTGGGAGAAGAAATAAAGGTAGGTAAGGA
TAGTTCAAACGCTTCGAAGAACTGTCTCAATGGAAGAAAGGTTTCTCCCT
ACTTTCAAAATGCATATCGTGAAAAGAAGAAGAGTACAATAGGTTCAAA
Genomic location of cLEC-7-P21  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2994 marker 2994
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)