SGN Marker cLER-14-H18

SGN-M2995

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C70348
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40340)
Chromosome
2
Position
2.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLER-14-H18 was used as an overgo probe on plate 11 [well B4]

Plausible BAC Matches:   P026F14,   P246H06,   P216C19,   P029E01,   P142A15,   P021A08,   P100J15,   P042G05

 Overgo Sequences

A sequence
GTACGAATACGAACCGTGAAAGCG
B sequence
AAGGATCGTTAGGCCACGCTTTCA
AB sequence
GTACGAATACGAACCGTGAAAGCGTGGCCT
Marker sequence
CTAAGATGAGCTCAACGAGAACAGAAATCTCGTGTGGAACAGAAGGGTAA
AAGCTCGTTTGATTCTGATTTCCAGTACGAATACGAACCGTGAAAGCGTG
GCCTAACGATCCTTTAGACCTTCGGAATTCGAAGCTAGAGGTGTCAGAAA
AGTTACCACAGGGATAACTGGCTTGTGGCAGCCAAGCGTTCATAGTGACG
TTGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCATTGTGAAGCAGAA
TTCACCAAGTGTTGGATTGTTCACCCACCAATAGGGAACGTGAGCTGGGG
TTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGACAGTGTCGC
AATAGTAATTCAACCTAGTACGAGAGGAACCGTTGATTCACACAATTGGC
CATCGCGCTTGGTTGAAAAGCCAGTGGCGCGAAGCTACCGTGTGCTGGAT
TATGACTGAACGCCTCTAAGTCAGAATCCGGGCTAGAAGCGACGCATGCG
CCCGCCGTCCGCTTGCCGACCCGCAGTAGGGGCCTTTGGCCCCCAAGGGC
ACGTGTCGTTGGCTAAGTCGCCGCGACGG
Genomic location of cLER-14-H18  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2995 marker 2995
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)