SGN Marker cLED-19-B18

SGN-M2998

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C17241
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40299)
Chromosome
2
Position
27.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLED-19-B18 was used as an overgo probe on plate 11 [well A4]

Plausible BAC Matches:   P025A22,   P254N13

 Overgo Sequences

A sequence
TTGAGGAATGAAGCCGGACCACTC
B sequence
CGCAGATATCACAGAGGAGTGGTC
AB sequence
TTGAGGAATGAAGCCGGACCACTCCTCTGT
Marker sequence
GCACCAGCCTTTGAGGAATGAAGCCGGACCACTCCTCTGTGATATCTGCG
ACCACTCTATAGAAAAACAGAGTGGTTGGATATATTATAACTATGGCCAT
AATTTTCTTTCGCATTTCGGGTGTGTTGCTGATATTGTATATGAGAAAGG
CGGAGATGATAAAGATTATATCATCGGTGTTAAAAGGGGACTGATTAATG
TCGATGGAGACGATACTTCTATAGTAAACTATCGAGATAACGACGAAGGA
ATTGTGAAACATAAGAGATTTTTTCATCGACATGTTCTGCAACAACTGGA
TAGGTCGATGGATAATAATAATAATAATAATAATAGTGTGAAGAATCGAA
AATGTGGTATTTGTGGTATGGATATAAGTTCAGATAAGAAAAAAGGATGT
TCGAGTTGTGATTTCATTATTCATGAGA
Genomic location of cLED-19-B18  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2998 marker 2998
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)