SGN Marker TG12

SGN-M300

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2000
Vector
pUC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
TG12 image not available
Forward sequence
CCATCTAAAAGCCTACTTGAGCAATGGATTTATAATGTGCCATACTACTACCGCACTCCATACAACTCAAGAAACCATAATTGATATCTC
AAATAATGGGATTAAGCATTTAATCAACATAGACCATGAGAGCGAGATCGTGGAATCAGAGGAATATGACCCCACAACGTAACAAGGTTA
TCCACTTGCCTAAGGGAAAATAGGTAATATTTAGATGTGGTAGAAACTATTGGATAATATATATCCCTCTGTGGCAATATAGTAATGGGA
TACAATGATGTGCATCAGAACACTATCATAACATTTGGCATGTTTCTTTCTTATCATATCCACTCGGTTCTTAGCCTCCATTCTCATAGA
GTAGTTCATTTACATTTCGTAAGTGTGCTTGAGAGGATGCAATTGGCCTATCTGACCCATGACACATCATTACACTTGAATGACATGACA
TATGCTTATCAATTAATTTTACACTACATGATATCTCC
Reverse sequence
CAACCATCTAAAAGCCTACTTGTGCAATGCATTTATAATGTCCCATACTACTACCGCACTCCATACAACTCAAGAAACCATAATTGATAT
CTCAAATAATGGGATTAAGCATTTAATCAACATAGACCATGAGAGCTAGATCATGGAATCAGTGCAATATGACCCCACAACGTAACAAGG
TTATCCACTTGCCTAAGGTAGAATAGGTAATATTTAGATTTGGTAGAAACTATTGGATAATATATATCCCTCTTTGGTAATATAGTAATG
GGATACAATGATGTTCATCAGAACACTATCATAACATTTGGCATGTTTCTTTCTTATCATATCCACTCGGTTCTTAGCCTCCATTCTCAT
AGAGTAGTTCATTTACATTTCGTTAGTGTGCTTGAGAGGATGCAATTGGCCTATCGACCCATGACACATCATTACACTTGAATGACATGA
CATATGCTTATCAATTAATTTTACACTACATGATATCTCCCTAACTTTCTAAAAAGGGTGCCTTTAACATAGAGT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8838)
Chromosome
10
Position
24.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG12 was used as an overgo probe on plate 16 [well E5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GTGTGCTTGAGAGGATGCAATTGG
B sequence
TCATGGGTCAGATAGGCCAATTGC
AB sequence
GTGTGCTTGAGAGGATGCAATTGGCCTATC
Marker sequence
CCATCTAAAAGCCTACTTGAGCAATGGATTTATAATGTGCCATACTACTA
CCGCACTCCATACAACTCAAGAAACCATAATTGATATCTCAAATAATGGG
ATTAAGCATTTAATCAACATAGACCATGAGAGCGAGATCGTGGAATCAGA
GGAATATGACCCCACAACGTAACAAGGTTATCCACTTGCCTAAGGGAAAA
TAGGTAATATTTAGATGTGGTAGAAACTATTGGATAATATATATCCCTCT
GTGGCAATATAGTAATGGGATACAATGATGTGCATCAGAACACTATCATA
ACATTTGGCATGTTTCTTTCTTATCATATCCACTCGGTTCTTAGCCTCCA
TTCTCATAGAGTAGTTCATTTACATTTCGTAAGTGTGCTTGAGAGGATGC
AATTGGCCTATCTGACCCATGACACATCATTACACTTGAATGACATGACA
TATGCTTATCAATTAATTTTACACTACATGATATCTCC
Genomic location of TG12  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D300 marker 300
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)