SGN Marker cLPT-2-K20

SGN-M3000

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C110156
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40462)
Chromosome
2
Position
33.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLPT-2-K20 was used as an overgo probe on plate 11 [well B3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGCAGCTGCTGTAAATGCTGATAC
B sequence
TATGGTTGGAGCTCCAGTATCAGC
AB sequence
GGCAGCTGCTGTAAATGCTGATACTGGAGC
Marker sequence
GCACTTTTGCGAGGCCTTTCCTTAGTGAAAGCTTTGAGTTTCATAAAGAC
ATCAAATTACATACCAAGAATTGTACCAGCCTCACGTTATCCTCTTCAAT
CTCAAAGGTCCTATGTAGCTGCTGCACATGATGAGGAAGCAGCTGCCAGG
GCAGCTGCTGTAAATGCTGATACTGGAGCTCCAACCATATTTGATAAAAT
CATTGCAAAGGAAATACCTGCTTCTGTGGTATATGAGGATCAAAAGGTTC
TTGCATTTCGGGATATCAATCCTCAAGCTCCTGTTCATGTTCTAATTATC
CCGAAGTCGAGGGATGGATTAACAGAGCTTGGAAAGGCTGAACAAAGACA
TGAAGATATATTGGGCAACCTCCTTTATGCTGCCAAGATAGTAGCGGAGA
AAGAAGGCATTGTAGATGGTTTTCGAGTTGTCATTAATAGTGGTCCCTCA
GCATGTCAATCTGTATACCATCTTCACTTGCACGTACTTGGCGGAAGACA
GCTGAAATGGCCCCCGGGTTAGAATCAAGCTTGGTTGGGAGCAAGTACTC
CATTTATCTGCATTGATGTAACATGACACGTGTACCGATGTTCAACATCT
GTGTCATGCAATAAGTACTATTGTTAGATGTGATTCAAGTATATTTGGTG
AATGACTAC
Genomic location of cLPT-2-K20  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3000 marker 3000
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)