SGN Marker cLET-1-A5

SGN-M3008

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C82144
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51084)
Chromosome
2
Position
41.13 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49020)
Chromosome
2
Position
88.30 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40364)
Chromosome
2
Position
79.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-1-A5 was used as an overgo probe on plate 12 [well G7]

Plausible BAC Matches:   P077A09,   P186C09,   P332L17,   P238L13

 Overgo Sequences

A sequence
TAGCTGCAGCCAATTCGTTTCCAG
B sequence
CCAGCAGTACCAAAACCTGGAAAC
AB sequence
TAGCTGCAGCCAATTCGTTTCCAGGTTTTG
Marker sequence
TGAAGTTCAATATTGTATCACCCGTTGCACTGTCTTGTCTCTTTTTCTTG
TTCCTAACAGGTACTTTAGCACAAAATGCCGGTTCCATTGTAACGCGGGA
ATTGTTCGAACAAATGCTGAGTTTTAGGAACAATGACGCATGTCCTGCCA
AAGGATTCTACACTTATGATGCATTCATAGCTGCAGCCAATTCGTTTCCA
GGTTTTGGTACTGCTGGTGATGATACTGCACGTAAGAAGGAAATTGCTGC
CTTTTTCGGTCAAACATCTCACGAAACTAATGGTGGTAGTGCAGGAACAT
TCACTGGAGGATATTGCTTTGTTAAGCAAATAGAGCAGTCAGACAGATAC
TATGGCAGAGGACCTATCCAATTGACACACCAATCTAACTACGAACGAGC
TGGACAAGGTATTGGTGTTGGACAAGAGTTAGTGAACAACCCTGATTTAG
TTGCGACAGATCCTATAAT
Genomic location of cLET-1-A5  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3008 marker 3008
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)