SGN Marker cTOB-9-L18

SGN-M3019

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C123198
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40507)
Chromosome
2
Position
112.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cTOB-9-L18 was used as an overgo probe on plate 11 [well C8]

Plausible BAC Matches:   P111M10,   P093M07

 Non-Plausible BAC matches

P106G08,   P124M10,   P024K21

 Overgo Sequences

A sequence
GCTCTTCTTCTTCCTCTGGAGATG
B sequence
CCAGCATCATTGTTCCCATCTCCA
AB sequence
GCTCTTCTTCTTCCTCTGGAGATGGGAACA
Marker sequence
TTCTATGGAGTCAATACTTGTTCAATACTAATAATTGAAGGGCTCAATTA
CCGCATTTTAGCTTCGATCCATTCATTGCCTTTGAATCCCCTTGCTTTTC
TTCTGAATCGGTTTTGGGTGTTTGCAAACTTCTGATATTTCCAATTCAAA
TAAAACTGAGTGAGATGCAGGACTCAACTACCAGGGCATTTGAAAGCTCT
TCTTCTTCCTCTGGAGATGGGAACAATGATGCTGGTGATTTTGAATGCAA
CATATGTTTTGAATTGGCCCAAGATCCCATTGTGACACTCTGTGGTCACC
TTTTCTGTTGGCCATGTCTGTATAGATGGTTACGTCTTCACTCACAGTGC
CATGAATGCCCTGTCTGTAAGGCACTTATTCAAGAGGAGAAGTTAGTTCC
ACTTTATGGAAGAGGAAGAACTTCTACTGATCCCCGATCAAAACCAATTG
CTGGCCTTGAAATTCCTAGTAGACCTGCTGGACAACGACCTGAAACTGCT
CCTCAACCTGAACCAAATCA
Genomic location of cTOB-9-L18  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3019 marker 3019
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)