SGN Marker cLPT-1-A21

SGN-M3021

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C109788
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51114)
Chromosome
2
Position
46.18 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49050)
Chromosome
2
Position
125.92 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40453)
Chromosome
2
Position
114.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLPT-1-A21 was used as an overgo probe on plate 10 [well F12]

Plausible BAC Matches:   P182O06,   P106G08,   P208B21,   P144N10,   P334M04,   P072F10,   P189B24,   P162C11,   P124M10,   P024K21,   P147E15,   P320E13,   P244A21,   P210D10,   P257N02,   P153J21

 Overgo Sequences

A sequence
TTTGGAGGTTCCACACACAGGATC
B sequence
GGTATTGTCCACCAGAGATCCTGT
AB sequence
TTTGGAGGTTCCACACACAGGATCTCTGGT
Marker sequence
GTTCATTTGGAAGTGTTTATTGCTTACCAGTTTCGGATTCACATAGCCAA
CTTCAACTTGTTTGGGATTGAGGCGTAGTTGTTGTACACCAGGGACAGGA
AATTGTGTTATGGGTTGGTTAGAAAAGATATTTGGAGGTTCCACACACAG
GATCTCTGGTGGACAATACCATGGTGGGTATGAGGGTGCGCAATATCATG
GGGGTTACGATGGAGGGCAATATCATTCGGGGCATGAAGGAGAACAATAT
CATGGAGGGTATAAGGACAGTACTACTTGGGACGGACCAACTACATCAGT
GGATGAATTGTCAGATTTTGATAAAGAAGAAATTGATCGTGCCATTGCAC
TTTCTCTAGCAGAAGAGGATCAGAAAGGGAAAAAAGTAATTGAGAGTGAA
CCCCATTTGGAGGAAGACGAGGCTCTCGCCAAGGCCCTTCAGGAAAGTTT
GAATGTGGAGTCTTCTTCACCACCACCACCACCTCGATATGATTATGGAA
GTCCCTTTCCCTCACTCTCATACTCGTTTTCGTATGGGTATAGGGTCTGT
GCCGGTTGCAATGCTGAAATTGGACATGGAAA
Genomic location of cLPT-1-A21  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3021 marker 3021
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)