SGN Marker cLEZ-17-J15

SGN-M3024

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C99439
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40450)
Chromosome
2
Position
124.00 cM
Confidence
F(LOD3)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40451)
Chromosome
3
Position
67.00 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLEZ-17-J15 was used as an overgo probe on plate 7 [well B3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ACATTCTGCTGGACTCCAGCTTTG
B sequence
TCAGCAACATGAGCTTCAAAGCTG
AB sequence
ACATTCTGCTGGACTCCAGCTTTGAAGCTC
Marker sequence
TGAAATCAAACAACATTCTGCTGGACTCCAGCTTTGAAGCTCATGTTGCT
GATTTTGGACTTGCTAAGTTCTTGCAAGATTCAGGGACATCAGAATGCAT
GTCTGCTATTGCTGGATCTTATGGGTACATTGCTCCAGAATATGCTTACA
CACTTAAGGTTGATGAGAAGAGTGATGTATATAGCTTCGGTGTGGTGCTA
CTAGAACTGGTAAGTGGCAAAAAACCAGTTGGAGAATTTGGTGATGGTGT
TGACATAGTCCAATGGGTTAGGAAAATGACTGATGGGAAAAAGGATGGAG
TTCTCAAGATCCTTGACCCAAGACTCTCAACGGTTCCCCTTAATGAGGTG
ATGCATGTCTTCTATGTCGCATTGTTGTGTGTCGAAGAGCAGGCTGTGGA
ACGTCCCACCATGCGAGAGGTAGTGCAAATACTAACGGAACTTCCCAAGC
CACCAGGTGCAAAATCAGATGACTCAACCGTCACTGATCAGACGCCCCCA
TCAGCCTCTGCATTAGAGTCCCCAACCTCAATTCCCGGGGACACAAAAGA
CCATCATCAACCAACACC

cLEZ-17-J15 was used as an overgo probe on plate 10 [well H9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ACATTCTGCTGGACTCCAGCTTTG
B sequence
TCAGCAACATGAGCTTCAAAGCTG
AB sequence
ACATTCTGCTGGACTCCAGCTTTGAAGCTC
Marker sequence
TGAAATCAAACAACATTCTGCTGGACTCCAGCTTTGAAGCTCATGTTGCT
GATTTTGGACTTGCTAAGTTCTTGCAAGATTCAGGGACATCAGAATGCAT
GTCTGCTATTGCTGGATCTTATGGGTACATTGCTCCAGAATATGCTTACA
CACTTAAGGTTGATGAGAAGAGTGATGTATATAGCTTCGGTGTGGTGCTA
CTAGAACTGGTAAGTGGCAAAAAACCAGTTGGAGAATTTGGTGATGGTGT
TGACATAGTCCAATGGGTTAGGAAAATGACTGATGGGAAAAAGGATGGAG
TTCTCAAGATCCTTGACCCAAGACTCTCAACGGTTCCCCTTAATGAGGTG
ATGCATGTCTTCTATGTCGCATTGTTGTGTGTCGAAGAGCAGGCTGTGGA
ACGTCCCACCATGCGAGAGGTAGTGCAAATACTAACGGAACTTCCCAAGC
CACCAGGTGCAAAATCAGATGACTCAACCGTCACTGATCAGACGCCCCCA
TCAGCCTCTGCATTAGAGTCCCCAACCTCAATTCCCGGGGACACAAAAGA
CCATCATCAACCAACACC
Genomic location of cLEZ-17-J15  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3024 marker 3024
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)