SGN Marker cLEX-2-I9

SGN-M3025

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C94129
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51109)
Chromosome
2
Position
48.46 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49045)
Chromosome
2
Position
147.58 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40441)
Chromosome
2
Position
133.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLEX-2-I9 was used as an overgo probe on plate 11 [well F2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATGCCCGATTCGGTAACAAATGGG
B sequence
AGTCGGGCTATAGTAGCCCATTTG
AB sequence
ATGCCCGATTCGGTAACAAATGGGCTACTA
Marker sequence
GAAAATGGCGATTACTACAAACAGTTCTAAGAGAGATATGGATCGGGTTA
AAGGTCCATGGAGCCCTGAAGAAGATGAGCTTTTACAGCAACTTGTTCAG
AAACATGGCCCGAGAAATTGGTCTCTAATAAGCAAATCGATTCCGGGGAG
ATCCGGAAAATCTTGCCGCTTGCGGTGGTGTAATCAGTTATCTCCACAGG
TGGAGCATCGGGCTTTTACGCCTGAAGAAGATGAGACTATTATTCGGGCT
CATGCCCGATTCGGTAACAAATGGGCTACTATAGCCCGACTTCTTAATGG
GCGGACTGATAACGCTATTAAGAATCACTGGAACTCTACCTTGAAGAGGA
AGTGTTCATCGCTTAGTGCCGATGAAGGGAACGAACTCGCCGATCAACTT
TTTGAGAATCAGCAGCCGCCGTTGAAGAGATCTGTTAGTGCCGGATCCGC
TATGCCGGTTACTGGTTTTCATTTCAGTCCGGGTAGCCCGTCGGGTTCTG
ATAGCGATTCGAGCCTTCATGTTACGTCGTCGTCCCAATCTCAAGTGTTT
AAGCCTGTTGCCAGAACCGGCGGCGTATTTCCGCCGTCGATTGATATTTC
ATCTCCGCCTGTTGATCCTCCCACTTCTCTAAGCCTTTCGCTTCCTGGTG
TTGACTTGGCTGAATCCTCTAATCGTTCGGCCGATTCGACTCAGTCG
Genomic location of cLEX-2-I9  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3025 marker 3025
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)