Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker cTOB-6-I3

SGN-M3026

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C122800
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40499)
Chromosome
2
Position
140.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cTOB-6-I3 was used as an overgo probe on plate 11 [well G3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGGTGATCGAGCACAAGTCTTACG
B sequence
AGCAGTCCAACTCTAGCGTAAGAC
AB sequence
AGGTGATCGAGCACAAGTCTTACGCTAGAG
Marker sequence
TGCGTGGGCTGCAGGTGATCGAGCACAAGTCTTACGCTAGAGTTGGACTG
CTTGGAAACCCTAGCGATGTTTATTTTGGGAACACTATATCCTTCAGCCT
CGGGAATTTTTGGGCTTCTGTTCGTTTGGAACCTTCTATAGATCTCGTCA
TTGTTCCTCATCCTTCTCACGATCTCGTCCAATTCAATTCAATTTCTCAC
CTGGTGAACAGGTTGCAGAATGAGGGGTACTATGGAGGGGTTCGTTTACT
TATGGCAATCGTTAAAATATTTCACAACTATTGCAAAGAGAGCAACATCA
CCTTACATGATGGGAATTTCACTCTCTCGTATGACACTAACATTCCCCGC
CAGACAGGGCTTTCAGGTTCTAGTGCAATCGTAAGTGCTGCACTGAGTTG
CCTTCTTGATTTTTACAAAGTCAGACATCTCATCAAAGTTGAGGTAAGGC
CGAACCTTGTCCTTAATGCAGAGAAGGAACTTGGAATTGTTGCAGGTCTT
CAAGATAGAGTGGCCCAGGTGTATGGAGGCGTTGTATATATGGACTTTGA
CAAGAATCACATGGATGAATTAGGTCATGGCATATATACACCCATGGATG
TTGATCTTCTCCCACC
Genomic location of cTOB-6-I3  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3026 marker 3026
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)