SGN Marker cLPT-2-E21

SGN-M3032

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C110072
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46794)
Chromosome
3
Position
44.40 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40460)
Chromosome
3
Position
61.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35667
Forward primer (5'-3')
CGAAGATGTTGCTTGATTGC
Digested band sizes (using EcoRI)
Solanum pennellii LA716: 1250
Solanum lycopersicum LA925: 1050+200
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCAGGAGCTGGACACAAT
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1250
Solanum lycopersicum LA925: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 43
Forward primer (5'-3')
Unknown
Digested band sizes (using EcoRI)
Solanum lycopersicum LA925: 200+1050
Solanum pennellii LA716: 1250
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1250
Solanum lycopersicum LA925: 1250
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
cLPT-2-E21 was used as an overgo probe on plate 6 [well F2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTTTTGGTGGACTCAATTCACCTC
B sequence
GCGGCAGCAAAATGAAGAGGTGAA
AB sequence
CTTTTGGTGGACTCAATTCACCTCTTCATT
Marker sequence
GGAGAAAATGGGTAATTCTTTTGGGTGTTCGGCCTCCGGTGAACGGTTGG
TATCGGCGGCCAGAGACGGCGATTATGTAGAAGCGAAGATGTTGCTTGAT
TGCAATCCATGTCTTTCAAAGTACTCTACTTTTGGTGGACTCAATTCACC
TCTTCATTTTGCTGCCGCTAAGGGACACAACGAGATTGTTGCATTGTTGC
TTGAGAATGGTGCTGATGTTAATTCTAGAAACTACTGTGGTCAGACGGCA
CTGATGCAGGCATGTCGATATGGTCACTGGGAAGTTGTTCAAACCCTTCT
TCTCTTTAGATGCAATGTTACCAGGGCAGATTATCTTAGTGGAAGAACAG
CTCTCCATTTTGCAGCAGTGAATGGACATGTTAGATGCATAAGACTTGTG
GTGACTGATTTCGTTCCTAGTGCCCCTTTTGAGTCTATAAATGCTCAAAC
AAATGCTGACAGAGGAGACAGTTCAAATTCAAAAGGCAAGCATGAGCAAA
GTCCACTGTCAAAATTTATAAATAAAGCTGCTGATGGTGGTATTACTGCT
CTTCATATGGCTGCATTGAATGGGTATTTTGATTGTGTCCAGCTCCTGCT
TGATCTCAATGCAAATGTTTCAGCTGTGACATTTCACTATGGGTCATCAA
TGGATCTGATA
Genomic location of cLPT-2-E21  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3032 marker 3032
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)