SGN Marker cLEB-7-J7

SGN-M3045

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C646
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40268)
Chromosome
3
Position
128.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLEB-7-J7 was used as an overgo probe on plate 6 [well E4]

Plausible BAC Matches:   P108K05,   P059L14,   P031J18,   P073P23,   P077L13,   P137I16,   P252J22

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CTCTTATCACCACCGCCCTCTAAG
B sequence
ATGGGTAAGGCTTGGACTTAGAGG
AB sequence
CTCTTATCACCACCGCCCTCTAAGTCCAAG
Marker sequence
AAAGAATTCGGCACGAGCTCTTATCACCACCGCCCTCTAAGTCCAAGCCT
TACCCATTTTCGCCGCTTCCCCGAGCAGTTCATAGACAGGGGAGAAGCAC
TCAAACAACGAAAAATGTAAATTCCTTGTCTTGTACTTCAATGACAACAA
AAATTGGCGTTGTTAACAAGTGGAATTGTTATGGACTGGAAGGAAAAGTT
AGATTTAGCAGAAGAGTAATGCTAATGCCAATCGTGAATGCAGCAGTGAC
GCAGCCTGTATCAGAAAATGAAAGAGAATCGAACTTTAAGAGGATTCTTC
TTTCTGATGTAGTCGTGACCCGGCCTAGGGATGTGCTTTGGGGAAGGAAA
TGGAATTCAATGGATATGGCCTCAGCTGCGGTGGTGGTGTCTATGCATTT
GCTCTGTCTATTTGCACCCTTTACTTTCAATTACGCTGCTCTTGGGATTG
CATTTGGGTTATATGTAATCACTGGACTTCTCGGTATTACACTTTCTTTT
CACAGAAACCTCTCTCATAGAAGTTTCAAACTTCCCAAATGGCTTGAATA
CTTTTTTGCCTATTGTGGTGTCCAAGCACTTCAGGGACATCCAATTGATT
GGGTGAGTACTCATAGGTACCACCATCAGTTTTGTGATTCAGAGAAAGAC
CCCTACAGTCCTTATGAAGGATTTTGGTTCAGTCATATGAGTTGGATGTT
T
Genomic location of cLEB-7-J7  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3045 marker 3045
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)