SGN Marker cLPT-5-B19

SGN-M3054

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C110449
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40469)
Chromosome
4
Position
21.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLPT-5-B19 was used as an overgo probe on plate 7 [well D5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CATCAGATCTGGTCGTTGGTTGAG
B sequence
ACACAAGCAAAGGCGGCTCAACCA
AB sequence
CATCAGATCTGGTCGTTGGTTGAGCCGCCT
Marker sequence
TAATTACCTCGCCTTCATCAGATCTGGTCGTTGGTTGAGCCGCCTTTGCT
TGTGTGCATCTCGATTGATTTATGGGGTTGCTTATTGTCTAGCTCACAAG
TACAGGTTTGGAGTTGAAATTTGAAACATAGCGTATCATATTTTCAAGCC
TTTGATGACTCAGACTGAGACCTCATTTTAGTAACTTTAACGAGAGGTTT
TGTTTGACTTATTCACGTGAAATGGCAGAGCTTTTCGGATATACAGCATG
CAGACAATTATTGCAAATGTTCATTTCAATTATATTCTTCCATGTTTCCG
AGTACATTCTGGCACTTGTCTTTCATGGGAAGTCGAATGTATCTTTTAAG
TCGCTTTTGATAAGCAAACATTATGTACTAGCAATGTTTTGCTCCTTGAT
AGAATACCTTATTGAAATCTATTTCTTTCCCGGCTTAAAGGAATATTGGT
GGATAAGTAATTTTGGCCTCGCAATGGTTGTTCTCGGAGAAATCATAAAG
AAGTTGGCAATTGTGACAGCTGGCCAAGCCTTCACTCATCTAATAAAGGT
TTATCA
Genomic location of cLPT-5-B19  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3054 marker 3054
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)