SGN Marker T1929

SGN-M3058
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39790)
Chromosome
4
Position
74.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1929 was used as an overgo probe on plate 7 [well A10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TAAGGATCCTGAGGAGCGAATGAG
B sequence
GGCATCTTTCAAAGCGCTCATTCG
AB sequence
TAAGGATCCTGAGGAGCGAATGAGCGCTTT
Marker sequence
CAGCAGCCAAGGAGTCGGACATGACAAAAGATGAGGTAAAGGATGTTCTT
TATCACTTGTATAAGACAACAAGAGGAAATCTTCAGAGGCTCATGCCAAA
AGAAATCAGAATTCTGAAATATCTACTCACGATTAAGGATCCTGAGGAGC
GAATGAGCGCTTTGAAAGATGCCTTCACACCTGGAGAAGAACTTGAAGGG
GAAGATGTAGATAATTTATACACGACTCCGGAGCAGCTATACAACTGGAT
AGGGACAGTGCTGGATGCATATAATTCCAGTAAAGAAGGCACTCTTATAA
AAGAAGCCAGAGACTTGATGAACCCTAAAATAATTAAGAAAATGGAGGAG
TTGAATAAGTTGATCGTAGATAACTTCATGTAAGCATTTGCTTGATCGTA
AGAAGGTACGAGCTTTGCCGTCAGTGTCCAGATTCATGCTCGTGCTATAA
ATCATCCATACGCAATATATCCCTACGATCAGGAGCATTGNGATGTTGCC
AAAAGTGTCGGTTGCAGTCC
Genomic location of T1929  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3058 marker 3058
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)