SGN Marker cLEX-14-G23

SGN-M3059

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C93338
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40438)
Chromosome
4
Position
83.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLEX-14-G23 was used as an overgo probe on plate 7 [well E2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGGTGGATTAGCATGGGAAACTCC
B sequence
GCGCATTACATCTGTTGGAGTTTC
AB sequence
TGGTGGATTAGCATGGGAAACTCCAACAGA
Marker sequence
GGTACAAACAAGATATGCCATTGTATATCCATTCCATATTATCGATCTTC
TAATTGCTTGAATAACAAGTCTAGTTTTCATTGGAAGTTTTTTAGATGCA
TTAATGGCGTATCAACATTATCGATCACCATTTGGGGACACAACTTACAC
CAAAGTTTTTGTTGGTGGATTAGCATGGGAAACTCCAACAGATGTAATGC
GCCGGTATTTCGAGCAATTCGGAGAGATTCTTGAAGCTGTCATTATCACA
GATAAAAACACTGGCAAATCTAAAGGATATGGCTTTGTAACTTATCGTGA
TCCGGAATCTGCAAGACGGGCTTGTGATAACCCGAATCCGGTAATTGATG
GAAGAAGAGCTAACTGTAACATCGCTTCTCTTGGACGGCCTCGTCCTTCA
CCACCTCGAGGTAGGGGACAAGGAGGGAATCCTTATCAAGGAGGGGGAAT
TCCACAAGGGGCATCATCATCATCTTACAGTGGGGTGGCAGGAGGAGCAG
CAGCACCATTACCATTACATCCACCACCTGCAACTCCTATGATATATTCA
CCATATGGGTATGCAACGTACCCTCCTGATTATTACCATCAAGCTGCGGG
GATGTACAATCCAAGGACGTACCAGCAAGCAGCAGCAGCAGCACATTATT
ATCAGCAAATGTATGGAAGTTCATCATCACCATCTCCAGCATATTATTAC
Genomic location of cLEX-14-G23  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3059 marker 3059
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)