SGN Marker T1975

SGN-M3060
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39816)
Chromosome
4
Position
84.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1975 was used as an overgo probe on plate 6 [well G10]

Plausible BAC Matches:   P214N09,   P168K01,   P169P20,   P043B10

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GAAACCATCAGAGCCTGGAAGAAG
B sequence
ACACTTCTCTGGTGTGCTTCTTCC
AB sequence
GAAACCATCAGAGCCTGGAAGAAGCACACC
Marker sequence
GTTCCTCACAATCGTCATCTTCTTCTCAACAGAGTTGGATGACAGTACTG
GGATTGTCCCAAAAGAAACCATCAGAGCCTGGAAGAAGCACACCAGAGAA
GTGTCTTAGGACTACTCAAAATGATACTAGCGAGGAGTCAAAGAAGCTTG
CTGCTGCTGCACTCTCTGCAGTAAAGGAGGCTGCCACCGCTGCTGCCTCT
GCAGGCCGGGTTAAAGTGATTACTGAAGTGCGAGATTTTGCTGGTGAAGA
TGTTGAAATAAAGAAATATGTTGACCACAATTCTGCAGAAGCATCTGATA
AAGGCAAAGGCCCCGCAGCACCTGCTTCTGCTGTTGATATCATCCTTGAA
CAAATAAAAAAGAAGCAGAAACTGAGTGTACTTGATAAGACAAAGAAAGA
CTGGGAGGGATTCAAGGGAGAAAATAGAGGGATGGAAGAAGAGCTGGATG
CTTACAAGAAGAGTTCCAATCAGTATCT
Genomic location of T1975  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3060 marker 3060
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)