SGN Marker CT264

SGN-M3061

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 42966)
Chromosome
4
Position
49.60 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 43966
Forward primer (5'-3')
CAGACCAAGAGCCAAGACTAACA
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
CGGTTTACGAGTGGCAAGGAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39041)
Chromosome
4
Position
86.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 12562)
Chromosome
4
Position
87.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Genomic location of CT264  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3061 marker 3061
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)