SGN Marker cLEC-7-B23

SGN-M3067

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C14174
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40284)
Chromosome
4
Position
101.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35661
Forward primer (5'-3')
GGAGAACACGGCTACCTCAG
Digested band sizes (using CfoI)
Solanum lycopersicum LA925: 520
Solanum pennellii LA716: 600
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTGGAAATGAGGTTTTGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 600
Solanum lycopersicum LA925: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 65
Forward primer (5'-3')
Unknown
Digested band sizes (using CfoI)
Solanum lycopersicum LA925: 520
Solanum pennellii LA716: 600
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 600
Solanum pennellii LA716: 600
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
cLEC-7-B23 was used as an overgo probe on plate 6 [well D12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGATGCAGCGTAACATTGCTAACC
B sequence
CCACACAAACCCTTTGGGTTAGCA
AB sequence
GGATGCAGCGTAACATTGCTAACCCAAAGG
Marker sequence
CATGGATTATTGGATTGTGAGGAACTCATGGGGTGCTTCCTGGGGAGAAC
ACGGCTACCTCAGGATGCAGCGTAACATTGCTAACCCAAAGGGTTTGTGT
GGTATTGCTACAGTTGTTTCTTACCCTGTCAAGACAGGCCAAAATCCCCC
GAAACCAGCTCCATCTCCTCCATCGCCAGTCAAGCCACCTACTACTTGTG
ATGATATGTACAGTTGCCCATCAGGAACAACGTGTTGCTGTGTCTACGAG
TACTATCACATGTGCTTTGCTTGGGGTTGCTGCCCTATGGAAGGAGCTAC
TTGCTGTAAAGACCATAACAGTTGCTGCCCACATGATTATCCTGTCTGCA
ATGTTAAAGCCGGCACCTGCTCAATCAGCGAGAATAACCCTCTTTCAGTC
AAAGCAATGTCACACATTCTTGCCAAACCTATTGGATCCTTCAGCAATCA
NGGAATGAAAAACACTATCTCTTGAAGTGTCTCCAATGGGGATGCGCAAA
TTCGCAGTGAATTTGCAAAACCTCATTTCCAGCTTGAAAGTTATAGTTAT
Genomic location of cLEC-7-B23  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3067 marker 3067
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)