SGN Marker cLED-19-B12

SGN-M3070

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C17235
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51070)
Chromosome
4
Position
62.11 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49006)
Chromosome
4
Position
105.84 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40298)
Chromosome
4
Position
115.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLED-19-B12 was used as an overgo probe on plate 6 [well E10]

Plausible BAC Matches:   P112K22,   P208P16,   P218O21,   P012H19,   P059L19,   P246J20,   P172L14,   P203J13,   P149L01,   P257A08,   P122G24,   P254K24,   P077A05,   P195C02,   P014E12,   P261A02,   P270L03,   P215H13,   P100M04,   P033P12,   P193O07

 Overgo Sequences

A sequence
GCTGCTGTTGAAGTTGAAGACCTG
B sequence
GCAGCAAACGCATCTTCAGGTCTT
AB sequence
GCTGCTGTTGAAGTTGAAGACCTGAAGATG
Marker sequence
GCACCAGATTCCTTTTAAGTTAATTCTATAGTAGGAGTATTTGTGGAGAG
CCACTTTGTTTCTTTTAAATCGTGATGTAAATGTTTCAATCTATGGAGAT
GCCGATTATGGCTCCCCTTTTGTGTAGCCTTCTGGGAAGTGTATTTTAGG
CAGGTTTGGGATTTTGACTGTTGAATTAATTCCGTGTACTGGGTAGATCT
TGTATCTGATTGGATGATGGAAAATTTGCAACTTAGAACTTGGGAATATC
TTTGTTTCTGATTCATGCTGTCTGGGGTCCCACCTTGTGGTGGGGAGTGT
TGCTCAGTTGATGCATGGATGTTTTACCTGGTGCGTTCTAGTTTTGTTTG
TGCTGTTGCTGCTGTTGAAGTTGAAGACCTGAAGATGCGTTTGCTGCTGT
TGGAAGTTAAATCATTTTGGTCACACTGTTTGGTTGTTCCTGTTACATTT
GGAAACACTCAACTTTTAAC
Genomic location of cLED-19-B12  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3070 marker 3070
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)