SGN Marker cLPT-1-K12

SGN-M3073

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C109924
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40458)
Chromosome
4
Position
135.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLPT-1-K12 was used as an overgo probe on plate 6 [well G3]

Plausible BAC Matches:   P074L17

 Non-Plausible BAC matches

P043P11,   P222J01,   P224I13,   P236H10,   P005I06,   P138H16

 Overgo Sequences

A sequence
AGAAACGGCAACAGGTGGATTCAC
B sequence
CCTTTTGCCTGCACTAGTGAATCC
AB sequence
AGAAACGGCAACAGGTGGATTCACTAGTGC
Marker sequence
GCTGCTCTTCGTCGCTCAATCTTCTTATCTCATCTCCATTTTACCCAAAA
GCAAAACTCACCACAAAAATCGTTTAGCCAAACACCATACACAATGGCCA
AAAAGAAGATGACCCCGCAAGATAATCAACCTCAAAACCCAACTGAAGTG
GTTAAGGAAAATCAGGTGAAAGAAAACAATCATTCCATTGCCATGGAAGA
AGCTTCTGAGAAACTTGAGAATCTCAAGAACCTCAACAGTATGCTTCTCA
AGGAGACTATTGAGAAACGGCAACAGGTGGATTCACTAGTGCAGGCAAAA
GGATGTCTGGAATCGGAACTTAAAAGGTCTAACTCGGAGAAAAATGAGTT
GCAGAATGAGTTGACTCAGTTGAGTGAACAGGTTATTCAGCTGGAGATTG
AGAAGAAATTGGTGTCTGTGTTTGTTGCTGTGCAGGTTGGTTACCACGCT
GAGGTGATTGAGAGTGAGAGGAATGGGTTTCGTGAACAGAATGACGTGGT
TGAGAAGAAGCTGAAGAGTGTAGAGATAGAAATGCGTGATGT
Genomic location of cLPT-1-K12  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3073 marker 3073
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)