SGN Marker T1933

SGN-M3075
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42387)
Chromosome
4
Position
121.70 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43844
Forward primer (5'-3')
AAAGCATCAGCCTTTCGTACA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GAGCATACACAGAACTTTTTATTATGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39791)
Chromosome
4
Position
136.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1933 was used as an overgo probe on plate 6 [well D10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GAGGACAGCCCTAATTAACTTAGC
B sequence
GGCACCAATAGCAATCGCTAAGTT
AB sequence
GAGGACAGCCCTAATTAACTTAGCGATTGC
Marker sequence
TATAATTAAAGCATCAGCCTTTCGTACATATCACACACCTCTTAACAAAC
AGGTTGACTATGTCAATTCTATGAGAGCTGCACGAGAATTCAGTTCAAGG
GTTTCTGATTCTCTAAAGATGGAGGTCTTCCCGTATGCAGTGTTTTATAT
GTTCTTTGAGCAATATTTAAGCATATGGAGGACAGCCCTAATTAACTTAG
CGATTGCTATTGGTGCCGTATTTATTGTATGCTTAGTTATCACTTGTAGT
TTTTGGACTTCAGCAATTATCTTGCTCGTGCTGACCATGATTGTTCTGGA
TCTTATGGGAGTAATGGCAATTCTAAAAATCCAGCTCAATGCTGTATCAG
TTGTTAACCTTGTGATGGCCGTTGGTATTGCTGTTGAATTCTGTGTCCAT
ATAACACATGCCTTCTTGGTTAGCAGTGGAGATAGAAACCAACGCATGAA
GGAGGCACTGACTACTATGGGCGCTTCTGTATTCAGTGGTATCACGCTTA
CAAAGCTTGTCGGTGTCATTGTTCTTTGTTTCTCAAGGACAGAAGTTTTT
GTGGTTTACTACTTTCAAATGTACCTGGCTTTGGTTCTTCTTGGTTTTCT
ACATGGGCTCATATTTTTACCTGGACTATTAAGCATTTTTGGTCCGCCAT
CAAGATGTGTGCTTGTAGAGAAGCAAGAAGATCGTCCATCTA
Genomic location of T1933  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3075 marker 3075
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)