SGN Marker cLET-8-B23

SGN-M3076

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C88403
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40416)
Chromosome
5
Position
10.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-8-B23 was used as an overgo probe on plate 11 [well C9]

Plausible BAC Matches:   P255D22,   P051O24,   P156C09,   P165D11,   P147N11,   P285B12,   P315A21,   P021I01,   P273H05,   P042B19

 Non-Plausible BAC matches

P173L15,   P320C20,   P052A14

 Overgo Sequences

A sequence
TATGTGGTTCGTGCCACAGTATGC
B sequence
AGCTATCCCGAGTAGTGCATACTG
AB sequence
TATGTGGTTCGTGCCACAGTATGCACTACT
Marker sequence
CTTGATTATTGCTTTAACAATCTGGATTACTTTCTATGATCGTGTTTTGG
TCCCTTTGCTATCAAAATATACTGGAAGGCCAAGAGGGCTAAGTCCTGTT
ACCCGAATGGGAATTGGGTTAACAGTCTCTTGTATGTCTATGGCATTGTC
AGCAATAACAGAAAGCATAAGACGAAAAAGGGCAATCACAGAAGGGCATG
AGGACGACCCAAATGCTTTAGTAAACATGTCTGCTATGTGGTTCGTGCCA
CAGTATGCACTACTCGGGATAGCTGAGGCTACCCATGGAGTTGGACAGAT
TGAATTCTTCTACACTCTATTACCGAAAAGCATGGCCAGCATCGCGTCAG
CTATGTACACTGTTGGAACTGCTGTGTCGAGTTTGATTGGAAGTATTCTG
GTGAGTAGTGAGGATTGGCTTACATCAAGGGGAGGTAAAACGAGCTGGCT
TTCTAGCAACATTAATAAGGGTCACCTGGATTACCATTTCTGGTTGCTTG
CTTTAATGAGTTTTCTCAACTTGTTATATTTTCTATGGGTCTGCCGGTTT
TATGAGACTGGGAATGATGAATTACCTCATGTGGCTGATGAGGAAGAGTG
TGATTATAGACTCTTACATGAATCTTGATGAT
Genomic location of cLET-8-B23  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3076 marker 3076
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)