SGN Marker TG535

SGN-M308

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1600
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG535 image not available
Forward sequence
TAGAAATGGATAAAAAAGAAAGTTATCCAACATCATGCAAGCTTCTAAATGCTTACCATAATGAGGTTGCTAATAAATTGAGTGCATTTT
AAGCTACATCAAACACTGCCAATTTCCAATTTCAACAAAACCGAGAATCAAGGAAATATTGGTTTTATCAATGTTTCTGTCCTCTGCCTG
CATGATAATCCATGACAGCATTGATGACGAACACTAATGTGATCCAGAATCAAAAAGCAAACATATACTCAATTTGATGGACCATCTCAT
CCAACAGATAAGGACAAAGATTATTTACGTTTTAACATGCTCCTAAGCCGTGAAAATACGTTGTTATTAACTAAAAAACACTTGAAGAAT
ATTAGATTGTATGACCAGTCATATCCCAAAAACTCAAGTTGTTCTAAAAATGGTACACTCATATGTACCAAGTCTGCAACACATAACTCC
AAATAATTGAGCGACTAACATGATTAAGGAGCAAC
Reverse sequence
GGAGAAAGCTTGCATGCCTGCAGAAGCGACTCATCTGTGCAACGATGTTGAAAACACATTCTAGTACACTTTTTATACCGCACCCATGCT
TCATGTAGTCTCTCATGTAGCTTCTGTTTGAATGTTGAAACACAGACACCTCAACTCCACAATCACTACCTGGGAAAAGAATTCATCCAA
AAAGCCTCCAAAAGCTCATCCCAGTTATGGATTGATTAAGCTGGAACAAACCATCTTTTTGATCCCTTGGTAACAAACCATCAACCTTTA
AAGTTGAAGGTGAATGATGTGTATTACATGAACAACCTCCTCTTATAGTTAATCTCATGCTATATCAATGGTTTTAACGAATTCAACCAT
TAAGTGAGAACATGCAATTTCCACTTTGAAGTTCTCTATAATTTGAGTATCAATAATTTTTATGTTAACGGTTATTTGGTTGCTAGGATA
CATGAAATAAATTAGGATATTTTATGAGATTAATTTCCACCTTTTATACCAGATAACCATCACACTTTTTTATATAGAATAGTTAATACC
ACTC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8852)
Chromosome
2
Position
25.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG535 was used as an overgo probe on plate 16 [well F3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCTGCCTGCATGATAATCCATGAC
B sequence
GTTCGTCATCAATGCTGTCATGGA
AB sequence
TCTGCCTGCATGATAATCCATGACAGCATT
Marker sequence
TAGAAATGGATAAAAAAGAAAGTTATCCAACATCATGCAAGCTTCTAAAT
GCTTACCATAATGAGGTTGCTAATAAATTGAGTGCATTTTAAGCTACATC
AAACACTGCCAATTTCCAATTTCAACAAAACCGAGAATCAAGGAAATATT
GGTTTTATCAATGTTTCTGTCCTCTGCCTGCATGATAATCCATGACAGCA
TTGATGACGAACACTAATGTGATCCAGAATCAAAAAGCAAACATATACTC
AATTTGATGGACCATCTCATCCAACAGATAAGGACAAAGATTATTTACGT
TTTAACATGCTCCTAAGCCGTGAAAATACGTTGTTATTAACTAAAAAACA
CTTGAAGAATATTAGATTGTATGACCAGTCATATCCCAAAAACTCAAGTT
GTTCTAAAAATGGTACACTCATATGTACCAAGTCTGCAACACATAACTCC
AAATAATTGAGCGACTAACATGATTAAGGAGCAAC
Genomic location of TG535  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D308 marker 308
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)