SGN Marker cLET-8-C14

SGN-M3087

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C88410
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40417)
Chromosome
5
Position
119.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-8-C14 was used as an overgo probe on plate 11 [well B10]

Plausible BAC Matches:   P202N16,   P013H09

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
ACAGGCCACTAGCAAAGGAACTAG
B sequence
GGAACCACCTTTATGCCTAGTTCC
AB sequence
ACAGGCCACTAGCAAAGGAACTAGGCATAA
Marker sequence
ATGTGGTCTTTCTGAAGCTGGACTGTAACCAGGACAACAGGCCACTAGCA
AAGGAACTAGGCATAAAGGTGGTTCCAACATTCAAGATTCTGAAGAACAA
TAAGATCGTTAAAGAAGTCACCGGAGCAAAACTTGATGATTTAGTAGCAG
CAATTGAGGGTGTGCGATCAAGTTAAATATTTCTTCTTTTTTTTTTCTAT
GACTTCTTCTGTTTAAATATGAAGCAGATAATGTCTATGAATGTCGTAAA
TTAGTTCTAACTAAATTCAGTGTATAGCCGTGGATAATGAAGTCTCATTA
GAGAAAATGGATGTGATGTACTTGGCTTGCCAATGTTTTTATTT
Genomic location of cLET-8-C14  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3087 marker 3087
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)