SGN Marker TG536

SGN-M309

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG536 image not available
Forward sequence
AGAAGTATTTCCAGGGCCACGGCTAGGCTAACGAATTTCAGCCATCCACTTACCCTACGTACGTTGTAGAACATCCTTGTACGTGCAACT
AACATTTCCAGGGCCGCCTTTTTCTGCCATGCAACCTTTTCCTGAAACTTGCTTGGTTGATTTACTTCTTCCATGTATAGAGGTGTAACA
TACTCAGAGTAACGAATTATGAAACGTTATTGACAATAACGTTTTATGTTTGTTTACTCTGTTAGATTTTTGTCTTTTTGTTGTTGAATT
TTCTTGAATAAAATATTACCTAAAACTTTACTGAGAACTACGTTTATAATAGTTTAGTAAAATTACAAAAAAACATATTATCCTGGTAAC
TTAATTTTAATAATGGCCTGCTTTGCTCAAAAATACACACCAGCAAACTACAAGTCCGTAACTCAAGTATAAGTAAATATTCTAAGTTCA
CATGTATGCAGGAAAAATCAAATTCCTCCATTTTTTCCTCT
Reverse sequence
GGAGACAGCTTGCATGCCTGCANATTCTCTAATTCCTTTTAAGAATCGATTCACTAAAAATAGTTCCTTTATTTTTAAATTTCTCAACTG
ATTGGGCTCAATTTTAGTCCATCTTATGGCGTACTTGTTTTATTGAGGTGTTAATAGGTGGAGGGGAAGGAGAATGGGAAATTATAAGGT
ATGGAATGGAATGTCACCAACATCATCTGGTATTGTTGTTGTTTATATTTCTTTTTTTGCAGGCTTTCTATTGCTTAACTTATTGGTTGT
TATGTTTACTTCCTATTTTCTTCTTTTGTATACTTAAATTTGTTGTATTTGCGTTGCAAGTCTTTCAGAAAACATTCTTTCTATCTCCAC
GAGGTAGTAGTAAAGCATGCAGTCACTTTACCCTACGCTGACTCCATCAATAGGATGTTTTATGTGCAAGTCACCACTATAATGTCATTT
CATTTATGAATTCCTCTTTTAGTATTGAAAATGGAAGTCTATATTTCTTTCTAAAAGAGAAGAAAACCTAAGGAAGTACCACATTGTCCA
CTTTTG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1483799.1e-0934 (6.9% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8853)
Chromosome
8
Position
6.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG536 was used as an overgo probe on plate 12 [well A8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGCTAGGCTAACGAATTTCAGCCA
B sequence
ACGTAGGGTAAGTGGATGGCTGAA
AB sequence
GGCTAGGCTAACGAATTTCAGCCATCCACT
Marker sequence
AGAAGTATTTCCAGGGCCACGGCTAGGCTAACGAATTTCAGCCATCCACT
TACCCTACGTACGTTGTAGAACATCCTTGTACGTGCAACTAACATTTCCA
GGGCCGCCTTTTTCTGCCATGCAACCTTTTCCTGAAACTTGCTTGGTTGA
TTTACTTCTTCCATGTATAGAGGTGTAACATACTCAGAGTAACGAATTAT
GAAACGTTATTGACAATAACGTTTTATGTTTGTTTACTCTGTTAGATTTT
TGTCTTTTTGTTGTTGAATTTTCTTGAATAAAATATTACCTAAAACTTTA
CTGAGAACTACGTTTATAATAGTTTAGTAAAATTACAAAAAAACATATTA
TCCTGGTAACTTAATTTTAATAATGGCCTGCTTTGCTCAAAAATACACAC
CAGCAAACTACAAGTCCGTAACTCAAGTATAAGTAAATATTCTAAGTTCA
CATGTATGCAGGAAAAATCAAATTCCTCCATTTTTTCCTCT
Genomic location of TG536  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D309 marker 309
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)