SGN Marker cLET-2-H1

SGN-M3090

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C84836
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40378)
Chromosome
6
Position
10.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-2-H1 was used as an overgo probe on plate 3 [well E6]

Plausible BAC Matches:   P304P16,   P114G19,   P257G07,   P154J19,   P250I14,   P120P08,   P069A06,   P288L16,   P097M11,   P143K21

 Overgo Sequences

A sequence
CAATTGGGTTACAGGAGGATGATG
B sequence
TGGGTACCCCTACATACATCATCC
AB sequence
CAATTGGGTTACAGGAGGATGATGTATGTA
Marker sequence
TCGAATTGCAAATTCAAAATATCTTCTTCTTCTTCACCCTAACACAGAGC
AAATAAAAATGGCGTCCATAGCCGGTGTTAGTATAACAATCCCAACAATT
TCATCCGATTCACCCAAAATTCAGCCCTTGAAATTGCAAACCCTAAACAG
CCCATGGAAGAAATCAAGTCAATTGGGTTACAGGAGGATGATGTATGTAG
GGGTACCCAAAGTAGTTCCGGATAAGAAGCTATCTGATTTAGTTGCGGAA
AGGGTTAAAGAAGCTGAAGAAACTTGTGCGGAGGATCCGGTGAGCGGCGA
GTGTAAGGCGGCATGGGATGTGGTGGAAGAGACGAGTGCAGCAGCGAGCC
ATGCGAGGGATAAGAAGAAGGAATCCGATGTTCTGGAGAATTATTGCAAG
GATAAT
Genomic location of cLET-2-H1  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3090 marker 3090
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)