SGN Marker T1965

SGN-M3092
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39812)
Chromosome
6
Position
11.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1965 was used as an overgo probe on plate 4 [well A6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGCTAAACCATGCACGACATGCAG
B sequence
GCTTCCCAGCCAAATGCTGCATGT
AB sequence
TGCTAAACCATGCACGACATGCAGCATTTG
Marker sequence
GGGATCATAACCATAAAAGAAAACTATACGTCTAAAGAGATATGGTCTGG
ACGCACTCCAAGGTAAAGAAGCTATTACAGACTCCATCATGAAAATAAAA
AGACACCCATAGAATCCACAGCATCTTAATTTCAGGTCATGGGGAAAACC
TTGGAGTTATTTGCAGCCAACAACAGATATTAATGGAAGTTTAATTGCTT
ATCATCGCAAAATGGATAGGAGGTGGTGGCGTGCTCAGGCAGTGCGCTAC
CTAATGCGGTTTCAGACTGAGTACACATGTAACTTGCTAAACCATGCACG
ACATGCAGCATTTGGCTGGGAAGCAGCACAAATGGTTCTCGAAAGTCAAT
TTACAGATTTTCCCGAGGGAGTAGAGAAAGCGGCAGCCAAACATGACATT
GAAAGTTTTGTGTGGTCAAGTCATAAACCTTGGAGTCCTAGGCCAATGCT
GAGCATGCATGTTCGAATGGGCGACAAGGCATGTGAGATGATAGTTGTAG
GGTTCAAAGAATACATGCATCTTGCTGAGCGTATAAGAAAGCACTTTCCT
AATCTTAAGAGCATCTGGCTTTCAACAGAAATGCAGGAAGTTATAGATCA
ATCAAGACTGTACCCTCATTGGACGTTTTACTACACAAATGTGA
Genomic location of T1965  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3092 marker 3092
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)