SGN Marker TG287

SGN-M31

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1400
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG287 image not available
Forward sequence
ACACTATACTCGATCGCTAGTTGAATCAGCTGTTCGAGCCTGGAGGACAAAATACCCTACTTCTAAAGTTGATGATTGTGCAGTTGTTTG
CCTTTTTCTTGATTCAAACTCAAACAACTTGTCCACTGCTTCCAATACAGAAGACAGTGACAAGACTGTCTCAATGAAAGCAAATGAAGT
TGGTGCCAAGACAGGTGATGCCTCAGGTCCAACTGCATTTACTCGTTCTGGAACTGTTCGAGAAGTTGAAGTTTCAGAAGAAGAGATAGA
GGAAGCATCAGAACATGAGGAACTGCTCTCAGAGGTGGGGGCGGAATGGTCTGCACTGGAAGGGGTTTCCCGGCTGAACACATTATTGAC
ACTGCCAAGGTTTGTGCCTGACAAGGACGAGAATTAAACTGTCTGGAATCGAACTCAAAGAAGCAACAGAGGGTGAGATTTCCAAGTTTG
GATTTATTTCTTTCGGTTATTTTTCAATTTTTATTTAGTTCCATCCATTTTAAGGTCTCACATATCTATCTACTGGGAGGGAAAAAAAAT
AGGGGCAT
Reverse sequence
CTGCCAAACGATTGGTACAATGATAAATTCATGGGATTTGCCATCTGTGTGGTGTCTGACCAAGAAACAACATGGTTATCAGTTCATGAA
GGTTACCTACAGGAAATGCCAGGCATTTCGATTGAGTTTACAATCAAAAGCCACCTACGGAGGAGCACGAGTTGCCTAATGAACATTGGT
TTTGTAGGGACAAACAAGAATGTTGCTTCAGATCACACATGCCTTGCCTATGTGGCATTTGAAGAATACTGGTCAATGTACAAAAACCAC
TTAGACACCCCAAACAATTGGTATCAAATCGATTTTTCTGCAAACTCATTGAGGAAACATATATTCCTAAAAAGTTGGGGAATTCGTCTA
GTGTACACTGATGACTTACAGAGTTTCACATCTTGAGCGATTTCCAGATGAGGTGTGTTCTCTCTGCTTTATATGCATGCCTGGCTTTTG
TAAGTATTTTGAAAATAATAAAGCAAATGTTATACTAAAACATCTCAACCCCATATATTAACAAAGTGCAAACGTTGATCAAAGAGATAC
GA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1523202.5e-0662 (11.3% of RFLP seq)+
SGN-U1572881.6e-0728 (5.1% of RFLP seq)+
SGN-U1534091.6e-0788 (16.1% of RFLP seq)+
SGN-U157288394 (71.9% of RFLP seq)+
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53881)
Chromosome
4
Position
62.60 cM
Confidence
uncalculated
Protocol
RFLP

2_Isobutylthiazole_content_ibt4_1 2_Methylthio_ethanol_content_meo4_1 Dry_matter_weight_dmw4_1 6_Methylhept_5_en_2_one_content_mhn4_1 Lycopene_content_lyc4_1 2_Methylbut_2_enal_content_bea4_1Color_L_L4_1 Color_a_a4_1Hexanal_content_hxa4_1 3_Methylpentan_1_ol_content_mno4_1 Elasticity_ela4_1 Color_b_b4_1Firmness_fir4_1
Tomato QTL map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50365)
Chromosome
4
Position
53.68 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48299)
Chromosome
4
Position
49.04 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39980)
Chromosome
4
Position
66.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 7806)
Chromosome
4
Position
49.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7807)
Chromosome
4
Position
48.30 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG287 was used as an overgo probe on plate 7 [well F4]

Plausible BAC Matches:   P325C20,   P111N17,   P104E04,   P080D03,   P073B21,   P204J24,   P042P08,   P332A15

 Overgo Sequences

A sequence
CGCTAGTTGAATCAGCTGTTCGAG
B sequence
TATTTTGTCCTCCAGGCTCGAACA
AB sequence
CGCTAGTTGAATCAGCTGTTCGAGCCTGGA
Marker sequence
ACACTATACTCGATCGCTAGTTGAATCAGCTGTTCGAGCCTGGAGGACAA
AATACCCTACTTCTAAAGTTGATGATTGTGCAGTTGTTTGCCTTTTTCTT
GATTCAAACTCAAACAACTTGTCCACTGCTTCCAATACAGAAGACAGTGA
CAAGACTGTCTCAATGAAAGCAAATGAAGTTGGTGCCAAGACAGGTGATG
CCTCAGGTCCAACTGCATTTACTCGTTCTGGAACTGTTCGAGAAGTTGAA
GTTTCAGAAGAAGAGATAGAGGAAGCATCAGAACATGAGGAACTGCTCTC
AGAGGTGGGGGCGGAATGGTCTGCACTGGAAGGGGTTTCCCGGCTGAACA
CATTATTGACACTGCCAAGGTTTGTGCCTGACAAGGACGAGAATTAAACT
GTCTGGAATCGAACTCAAAGAAGCAACAGAGGGTGAGATTTCCAAGTTTG
GATTTATTTCTTTCGGTTATTTTTCAATTTTTATTTAGTTCCATCCATTT
TAAGGTCTCACATATCTATCTACTGGGAGGGAAAAAAAATAGGGGCAT
Genomic location of TG287  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D31 marker 31
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)