Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker TG390

SGN-M310

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1800
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TTGCATGCCTGCATCTCCTCTTTGCACGTAGATCACGCTGTGTCCATTCACTGACCAGTGAGGGCTCATCAGTGCATTCTGCAATCCACC
AATTTTAATCAATTCCAAGTCAATAGTACTAGAAGAATTATTTTTTTTATTTTTGAGCAATTTAGAAATAACGTTGACTGAATTACCGGA
TATTGGGTTCCTTTAGAGGCGCTCATGTCCGTGTGGCTAAGGATGGGAAAATTTTG
Reverse sequence
CAAATGCATATAGACAATATCCGTTTCAGCAAGGTCAGCACGGTCAGAGAAGCATTCCTCTGACTCAAGCTCAACAATGCCGCTTACAGA
GGCTTACTGGAAGCCAGCCCTCTCAGCGCATTGAGTCAGAGGGCGGCTACACTGAGGTGTGGGATGACAATGAGGAGCAATTCCAGGGTG
TTGGAGTTGCGCCTATGAGGAATGTTATTCGTCGAAATTCTCTCTCTTTGCCTAATTATCATCCCAT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1485694.5e-1560 (25.4% of RFLP seq)+
SGN-U1485691.4e-3066 (28.0% of RFLP seq)+
SGN-U1485697e-122247 (100.0% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53293)
Chromosome
9
Position
65.77 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_9
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42452)
Chromosome
9
Position
56.10 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40024)
Chromosome
9
Position
53.70 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8854)
Chromosome
9
Position
50.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 8856)
Chromosome
9
Position
60.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8855)
Chromosome
9
Position
57.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8860)
Chromosome
9
Position
32.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG390 was used as an overgo probe on plate 5 [well H11]

Plausible BAC Matches:   P299N06,   P281K16,   P124A20,   P101H07,   P310C06,   P274P21,   P070L20,   P150H17,   P107P11,   P117A07,   P238A11,   P324K08,   P061H03,   P016P11

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GCATCTCCTCTTTGCACGTAGATC
B sequence
TGAATGGACACAGCGTGATCTACG
AB sequence
GCATCTCCTCTTTGCACGTAGATCACGCTG
Marker sequence
TTGCATGCCTGCATCTCCTCTTTGCACGTAGATCACGCTGTGTCCATTCA
CTGACCAGTGAGGGCTCATCAGTGCATTCTGCAATCCACCAATTTTAATC
AATTCCAAGTCAATAGTACTAGAAGAATTATTTTTTTTATTTTTGAGCAA
TTTAGAAATAACGTTGACTGAATTACCGGATATTGGGTTCCTTTAGAGGC
GCTCATGTCCGTGTGGCTAAGGATGGGAAAATTTTG
Genomic location of TG390  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D310 marker 310
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)