SGN Marker cLET-2-L2

SGN-M3100

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C84926
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40379)
Chromosome
6
Position
43.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-2-L2 was used as an overgo probe on plate 5 [well H1]

Plausible BAC Matches:   P234C14,   P101G09,   P051F05,   P148G23,   P148K01,   P197J07,   P332H16,   P047A05,   P301I04,   P279J23

 Non-Plausible BAC matches

P143F24,   P202H17,   P263L10

 Overgo Sequences

A sequence
GCAGTTTTGGAGCTGTTGAAAGTG
B sequence
TCACTGGTGGCTTTGACACTTTCA
AB sequence
GCAGTTTTGGAGCTGTTGAAAGTGTCAAAG
Marker sequence
GGTGGTTCTGTTTCCCAAGGAAGCAGTTTTGGAGCTGTTGAAAGTGTCAA
AGCCACCAGTGACATTAATTGTCCTATCTCTGGCGAGATTGTTGAGGTCA
ACACAAAGCTTTCTGAAACGCCCGGCTTGATAAATTCGAGCCCATATGAA
GATGGATGGATGATTAAAGTGAAGCCAAGCAGCCCATCAGAACTAGAATC
TTTGATGGGATCGAAAGAGTACACAAAATTCTGTGAAGAAGAGGATAGTC
ATTAACACATGAATTAAAGTGCTGCTTAATTCATCTTGGACTAACTCGNT
ATGTGCTTAAGGGTGATATTGGTATAAGATTTCCCAGTCAATGTATAAAA
TTGTTCAAGCATTACCGGCATCTTTGCCTATGCAGTTTTATAATTCAATC
TTCTGTTATT
Genomic location of cLET-2-L2  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3100 marker 3100
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)