SGN Marker cTOB-6-M19

SGN-M3101

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from a(n) EST clone (ID unknown)
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40500)
Chromosome
6
Position
43.80 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cTOB-6-M19 was used as an overgo probe on plate 14 [well A2]

Plausible BAC Matches:   P069O12,   P175H08

 Non-Plausible BAC matches

P239O15,   P291N15,   P052A03,   P026C13,   P143H09,   P004H22,   P271P13,   P265L16

 Overgo Sequences

A sequence
GGTTAGGGAGAAAGTTAGGGAACA
B sequence
CCACCAAACTTTCCCTTGTTCCCT
AB sequence
GGTTAGGGAGAAAGTTAGGGAACAAGGGAA
Marker sequence
GGATGCCCATTTGTTAAAAAAAGCTCAGTTTTTGCTATTTAATGGTAAAA
ATTTGGCCTTTCTTTGAATTATTGGATATCCCATGTGTAAAAAAGCTCAA
TTTTTGCAATTTAATGCTAAAAATTTGACCTTTCTTTGAATTCTTGGATA
CCTATATGTAAAAAGATTCAATTTTTATACTTTTATGTTAAAGTTGAGAG
CTTGTTTTGTGTGAAATCCAAAAAATGTATGGAACCCATAGCAAGAGAGA
CATGGAGATTGAATATCAATCTCAAGTTCCAATTTTGAGGCCAAGTATAC
ATGCCAGAAGGGCAAAGATTACTGTGAAATTTCAAGATCTGTATGGATTT
ACTGTTGAAGGGAATGTTGATGATGTTAATGTGTTGAATGAGGTTAGGGA
GAAAGTTAGGGAACAAGGGAAAGTTTGGTGGTCATTAGAAGCTAGCAAAG
GTGCTAATTGGTATTTGCAAACTCATGTTTCCTCAACCCTTAAAACATCC
CTCAAATTCTCTGCTTTGGTGAATGCAATTACTCTCAAGAAGCTCATTAG
GAAAGGAATTCCACCTGTTTTGAGGCCTAAGGTGTGGTTTTCACTATCAA
GAGCTGCTAAGAAGAAATCGACTGCCCCGGATAGTTATTATGAGGATTTG
ACA
Genomic location of cTOB-6-M19  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3101 marker 3101
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)