SGN Marker cLET-8-I22

SGN-M3103

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C88526
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40423)
Chromosome
6
Position
44.30 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-8-I22 was used as an overgo probe on plate 14 [well C4]

Plausible BAC Matches:   P032D19

 Overgo Sequences

A sequence
ATTTCGAGCCAGAGGAAGACGATC
B sequence
ACGTCTTCGTCCATCAGATCGTCT
AB sequence
ATTTCGAGCCAGAGGAAGACGATCTGATGG
Marker sequence
GCTGCAGCGGCGAAAATGGCGAACCCGGAGGAGGCTGTGGATTTCGAGCC
AGAGGAAGACGATCTGATGGACGAAGACGTTGACGCTTCATCACCTAGGG
CACCGATGCCAAAGCTGAAATCAGCCATTACAGGTGGCGGCGGCGGTTCT
TCTGCTTCTAAGAAAATCAAAGGACGGGGTTTCCGTGAAGAGACTGCTGA
GGCTGAAAGGAATGCTCGCCTTTCTGCTCGATTTGATTCACTTGACTCCG
AAGGTGGCCCTGGACCTGAACGATCCATTGAAGGATGGATTATTTTAGTC
ACTGGAGTCAATGAGGAGGCACACGAAGATGATCTTCATAATACATTTGG
TGAGTTCGGGGAGATCAAGAATTTGCATTTGAATCTGGATCGTCGTTCTG
GATTTGTCAAGGGTTATGCACTTATTGAATATGAAAACTTTGAAGAAGCA
GAGAGAGCTATTAGTGAAATGGATGGGAATGAGCTGCTAACTCAGACTAT
ACATGTTGATTGGGCATTCA
Genomic location of cLET-8-I22  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3103 marker 3103
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)