SGN Marker cLET-5-C8

SGN-M3104

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C87573
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51103)
Chromosome
6
Position
37.07 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49039)
Chromosome
6
Position
49.20 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40396)
Chromosome
6
Position
45.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-5-C8 was used as an overgo probe on plate 4 [well D12]

Plausible BAC Matches:   P286N17,   P108P16,   P237I12,   P211F22,   P194N16,   P279A05

 Overgo Sequences

A sequence
GACGACGATTCGTAGATTCAGCTG
B sequence
GCGAAGCAAGTCATTGCAGCTGAA
AB sequence
GACGACGATTCGTAGATTCAGCTGCAATGA
Marker sequence
CCAGAAGAGTTCCGTATAGAGAGAAAGAGACGAAGAAGAGAGAGAAAGCA
TGACGACGATTCGTAGATTCAGCTGCAATGACTTGCTTCGCTTCGCGTCA
GTGAATTTGGATCATCTTACTGAAACTTTCAACATGTCATTTTATATGAC
TTACATGGCAAGATGGCCGGATTATTTCCATGTTGCAAAAGCTCCCGGCG
GCCACATCATGGGATACATTATGGGAAAAGTTGAAGGGCAAGGTGAATCT
TGGCATGGTCACGTTACTGCAGTAACTGTGGCTCCTGAATATCGGAGGCA
GCAATTAGCCAAGAAATTGATGTT
Genomic location of cLET-5-C8  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3104 marker 3104
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)