SGN Marker cLET-20-H7

SGN-M3106

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C82578
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40369)
Chromosome
6
Position
67.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-20-H7 was used as an overgo probe on plate 5 [well E6]

Plausible BAC Matches:   P009C19,   P009A10,   P032F09,   P173A15,   P222C01,   P229B01,   P151F03,   P173M12

 Overgo Sequences

A sequence
AGCCTCGCTTTTCTGTGAAGATGG
B sequence
CAGATGTTAGAGTGACCCATCTTC
AB sequence
AGCCTCGCTTTTCTGTGAAGATGGGTCACT
Marker sequence
CAAAAGTAGGGTTTTCTTGCAAACACATCGCGCAGCCTCGCTTTTCTGTG
AAGATGGGTCACTCTAACATCTGGAACGCTCACCCAAAGAACTACGGCCC
TGGCTCTCGCACATGCCGTGTGTGTGGTAATCCTCATGCAATTATTAGAA
AGTATGGACTCATGTGTTGCAGACAGTGCTTCCGCAGCAATGCCAAGGAA
ATTGGCTTCATCAAGTACCGTTAAAAATCTTGAATACGAGTTTCTACGAG
GACCTCTACATTTGGTGCTGGTAGAAGACATATGGCATTAGAGCTTTTTG
ATTTGCATCTCCCTTCAGTTAAATGATGTAATGGGATAATTTTGATTTAT
GTTTTAACTTTTGGAAGTAACTGCTATGTGAACCTAAGAAAGACTAGCTT
TTAAGATTTTATATTTTGTTCAN
Genomic location of cLET-20-H7  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3106 marker 3106
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)