SGN Marker cLPT-5-P17

SGN-M3107

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C110703
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40475)
Chromosome
6
Position
68.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLPT-5-P17 was used as an overgo probe on plate 5 [well D3]

Plausible BAC Matches:   P143C01,   P066A21

 Overgo Sequences

A sequence
GAAGTTTTGGGAGGTCACTAGGAC
B sequence
TCGCAGTACGAACCTTGTCCTAGT
AB sequence
GAAGTTTTGGGAGGTCACTAGGACAAGGTT
Marker sequence
AAAAGAAAGCATAATTGATGCATAGTCACACCACCAGGTTAATCTCTATG
CATTTTACAGATACATAGCAAAATTGTTCCGGAGAACAGAAGCGCGAAAA
ATATGCATGAGACCTGAATATGGCAACAGACCTAGTACTGTACCAAATAA
CTAAGAAGTTTTGGGAGGTCACTAGGACAAGGTTCGTACTGCGAGTGCTG
TCAAACTAGAGCTATTTACAGAAACCATTTGTCTAGAGCATACATTAACC
GCGTAGAGTAAAACAGGAGGCGCACAGGCCTCAACAGAAGAACATGGAGC
TAGCAACGTTCTCCTGAAGACGGGGCAATTGAGGAACAGTAACTGGACCG
GCATTAGTCAGACCACCATGGCTTGACGATGTCTCTGATGCATCCTCGAA
TTTCATCCATTGACCCACCTGTGTGGCGGCCAAATGGGCATAACTTATCG
GAGCCACAATGGATATAGCAGTAGTGCTTCTTTGGTACACATAGGACAGA
TTATGAACAAGTTCTTGAAGTTCATCA
Genomic location of cLPT-5-P17  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3107 marker 3107
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)