Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker TG609

SGN-M311

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1900
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
GAGACAGCTTGCATGCCTGCAGAGGTGATAAATTCACCAAGGTTTCATATTTAGGAAACAAGAAAATTAAAAGATCATTAACACAGATGA
AAGGATATGACTAGGAGGCAATGACTGATCTTTGACTATCAAATACTTCTCAGGGAAACAATGTGAATGGGCTTTTACATGCAGAGATAT
TGATTGTGATCATGTTGAAGAACTTAGGAAACATGAAATTAAATGATCATTAACACTGATGCAAGGATATGCCAAGTAGGCAAGCAAATT
AAGGTTGAACATAAATGTCTGTGATCTTTGACTATCAAATATCTTCTCAGAAAAAAAAATGTGAATGCTCATTTACATGCAGAGATGGCT
ATTGTGATCATGTGGCTCAGCCTTGAGTCTATATTGAGGTGCAGACAACATAGTCCCTAACCACATGTGTGATCAAGCAACTTTTTTGAT
GTCCACAGGGTTATAAGTAGGCAACATTTAAGCAAGAAAAAACACAGGATCACTATTGAGTCAGCTGCTGTTGCCTGT
Reverse sequence
GGAGACAAGCTTGCATGCCTGCAGAGGTGATAAATTCACCAAGGTTTCATATTTAGGAAACAAGAAAATTAAAAGATCATTAACACAGAT
GAAAGGATATGACTAGTAGGCAATGACTGATCTTTGACTATCAAATACTTCTCAGGGAAACAATGTGAATGGGCTTTTACATGCAGAGAT
ATTGATTGTGATCATGTTGAAGAACTTAGGAAACATGAAATTAAATGATCATTAACACTGATGCAAGGATATGCCAAGTAGGCAAGCAAA
TTAAGGTTGAACATAAATGTCTGTGATCTTTGACTATCAAATATCTTCTCAGAAAAAAAAATGTGAATGCTCATTTACATGCAGAGATGG
CTATTGTGATCATGTGGCTCAGCCTTGAGTCTATATTGAGGTGCAGACAACATAGTCCCTAACCACATGTGTGATCAAGCAACTTTTTTG
ATGTCCACAGGTTTATAAGTAGGCAACATTTAAGCAAGAAAAAACACAGGATCACTATTGAGTCAGCTGCTGTTGCCTGTTACTGAG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53575)
Chromosome
4
Position
49.70 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8861)
Chromosome
4
Position
38.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG609 was used as an overgo probe on plate 10 [well A8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GAGATGGCTATTGTGATCATGTGG
B sequence
TAGACTCAAGGCTGAGCCACATGA
AB sequence
GAGATGGCTATTGTGATCATGTGGCTCAGC
Marker sequence
GAGACAGCTTGCATGCCTGCAGAGGTGATAAATTCACCAAGGTTTCATAT
TTAGGAAACAAGAAAATTAAAAGATCATTAACACAGATGAAAGGATATGA
CTAGGAGGCAATGACTGATCTTTGACTATCAAATACTTCTCAGGGAAACA
ATGTGAATGGGCTTTTACATGCAGAGATATTGATTGTGATCATGTTGAAG
AACTTAGGAAACATGAAATTAAATGATCATTAACACTGATGCAAGGATAT
GCCAAGTAGGCAAGCAAATTAAGGTTGAACATAAATGTCTGTGATCTTTG
ACTATCAAATATCTTCTCAGAAAAAAAAATGTGAATGCTCATTTACATGC
AGAGATGGCTATTGTGATCATGTGGCTCAGCCTTGAGTCTATATTGAGGT
GCAGACAACATAGTCCCTAACCACATGTGTGATCAAGCAACTTTTTTGAT
GTCCACAGGGTTATAAGTAGGCAACATTTAAGCAAGAAAAAACACAGGAT
CACTATTGAGTCAGCTGCTGTTGCCTGT
Genomic location of TG609  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D311 marker 311
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)